Mutagenetix > Incidental Mutation

Incidental Mutation 'R4692:Sbno2'

354982

Institutional Source

Beutler Lab

Gene Symbol

Sbno2

Ensembl Gene

ENSMUSG00000035673

Gene Name

strawberry notch 2

Synonyms

Stno

MMRRC Submission

041943-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4692 (G1)

Quality Score

116

Status

Not validated

Chromosome

Chromosomal Location

80056992-80105571 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80086327 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 4 (V4A)

Ref Sequence

ENSEMBL: ENSMUSP00000151835 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042771] [ENSMUST00000218630] [ENSMUST00000219258] [ENSMUST00000219260]

AlphaFold

Q7TNB8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042771
AA Change: V4A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000041635
Gene: ENSMUSG00000035673
AA Change: V4A

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
low complexity region	177	189	N/A	INTRINSIC
Pfam:AAA_34	209	500	8.2e-135	PFAM
Pfam:ResIII	239	419	7.7e-8	PFAM
low complexity region	611	631	N/A	INTRINSIC
Pfam:Helicase_C_4	726	1004	7.5e-120	PFAM
low complexity region	1263	1283	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217683

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218462

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218630
AA Change: V4A

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219258
AA Change: V4A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219260
AA Change: V4A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired osteoclast fusion, impaired osteoblastogenesis, osteopetrosis, increased bone mass, and decreased body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	A	T	10: 28,973,886	Y230*	probably null	Het
9230104M06Rik	A	T	12: 113,000,072		probably benign	Het
Arhgap20	A	G	9: 51,785,788	D53G	probably damaging	Het
Arl2	T	C	19: 6,137,746	T54A	probably damaging	Het
Baz2a	G	A	10: 128,124,893	G1521S	probably damaging	Het
Begain	A	G	12: 109,033,892	S523P	probably damaging	Het
Car10	T	C	11: 93,185,158		probably null	Het
Cenpe	A	G	3: 135,216,379	I66V	probably benign	Het
Col14a1	T	A	15: 55,423,468	V895E	unknown	Het
Coro1b	T	C	19: 4,149,419	Y26H	probably damaging	Het
Crebbp	T	C	16: 4,114,863	E1017G	possibly damaging	Het
Cwf19l2	T	C	9: 3,428,709	S232P	probably damaging	Het
Cyp7b1	T	A	3: 18,072,564	I473F	probably damaging	Het
D430042O09Rik	T	C	7: 125,867,669		probably null	Het
Efcab5	A	T	11: 77,113,681	I937N	probably damaging	Het
Fam53c	A	C	18: 34,768,690	E220A	probably damaging	Het
Gsn	A	G	2: 35,298,871	Y434C	probably damaging	Het
Igkv2-137	T	C	6: 67,555,987	S45P	possibly damaging	Het
Kif13b	C	A	14: 64,803,575	T1704K	probably benign	Het
Mapk7	A	G	11: 61,489,242	S697P	possibly damaging	Het
Mrgpra1	T	A	7: 47,335,698	I78F	probably damaging	Het
N6amt1	T	C	16: 87,356,966	V97A	possibly damaging	Het
Oas3	T	C	5: 120,769,355	T406A	probably benign	Het
Olfr1314	A	G	2: 112,092,681	S7P	probably damaging	Het
Olfr895	C	T	9: 38,268,530	Q6*	probably null	Het
Paxip1	T	C	5: 27,772,097		probably benign	Het
Pfn4	A	T	12: 4,774,486	Y71F	probably damaging	Het
Plin4	C	A	17: 56,103,762	G1090C	probably damaging	Het
Ptk2b	C	T	14: 66,157,069	G859S	probably benign	Het
Rbl2	T	A	8: 91,122,419	D1084E	probably damaging	Het
Robo1	T	G	16: 72,960,202	S350R	probably damaging	Het
Sh3rf1	T	C	8: 61,353,854		probably null	Het
Smgc	T	C	15: 91,854,561	V474A	possibly damaging	Het
Snx13	A	G	12: 35,086,918	D126G	possibly damaging	Het
Sox9	C	A	11: 112,782,977	H131Q	probably benign	Het
Spag6	T	C	2: 18,699,243	I34T	probably benign	Het
Speer2	T	A	16: 69,857,972	T202S	possibly damaging	Het
Sspo	T	A	6: 48,482,687	C3327S	probably damaging	Het
Vcpip1	G	T	1: 9,748,074	A28E	unknown	Het
Vstm5	A	T	9: 15,257,422	D94V	probably damaging	Het
Zfp329	T	C	7: 12,810,632	K322E	probably damaging	Het
Zfp932	G	A	5: 110,009,186	G250D	probably damaging	Het
Zscan26	A	G	13: 21,445,257	C359R	probably damaging	Het

Other mutations in Sbno2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Sbno2	APN	10	80064506	splice site	probably benign
IGL01773:Sbno2	APN	10	80057831	missense	probably damaging	1.00
IGL01869:Sbno2	APN	10	80060392	critical splice donor site	probably null
IGL01911:Sbno2	APN	10	80069624	nonsense	probably null
IGL02071:Sbno2	APN	10	80060641	missense	probably damaging	1.00
IGL02094:Sbno2	APN	10	80057645	missense	probably benign
IGL02220:Sbno2	APN	10	80072368	missense	probably benign	0.04
IGL02366:Sbno2	APN	10	80064202	missense	probably damaging	1.00
IGL02608:Sbno2	APN	10	80067402	splice site	probably null
IGL03007:Sbno2	APN	10	80058550	splice site	probably benign
IGL03083:Sbno2	APN	10	80057534	missense	probably damaging	0.98
IGL03393:Sbno2	APN	10	80066901	missense	probably damaging	1.00
Narcissus	UTSW	10	80062208	missense	probably damaging	1.00
psychopomp	UTSW	10	80060016	missense	probably damaging	0.99
Unsafe	UTSW	10	80060215	missense	probably damaging	1.00
R0034:Sbno2	UTSW	10	80058340	splice site	probably benign
R0126:Sbno2	UTSW	10	80068853	splice site	probably null
R0652:Sbno2	UTSW	10	80067294	missense	probably damaging	1.00
R0964:Sbno2	UTSW	10	80084259	missense	possibly damaging	0.75
R1571:Sbno2	UTSW	10	80060392	critical splice donor site	probably null
R1601:Sbno2	UTSW	10	80060492	missense	probably damaging	0.98
R1634:Sbno2	UTSW	10	80060634	missense	possibly damaging	0.73
R1733:Sbno2	UTSW	10	80058508	missense	possibly damaging	0.92
R1762:Sbno2	UTSW	10	80066606	missense	probably damaging	1.00
R1832:Sbno2	UTSW	10	80060605	nonsense	probably null
R1859:Sbno2	UTSW	10	80058639	nonsense	probably null
R2086:Sbno2	UTSW	10	80057856	missense	possibly damaging	0.89
R2136:Sbno2	UTSW	10	80062693	missense	probably damaging	1.00
R2360:Sbno2	UTSW	10	80058021	missense	possibly damaging	0.81
R4426:Sbno2	UTSW	10	80072358	missense	probably null	0.02
R4504:Sbno2	UTSW	10	80060492	missense	possibly damaging	0.46
R5044:Sbno2	UTSW	10	80062188	missense	probably benign	0.11
R5166:Sbno2	UTSW	10	80066928	nonsense	probably null
R5576:Sbno2	UTSW	10	80067337	missense	probably damaging	0.99
R5665:Sbno2	UTSW	10	80058453	missense	probably benign	0.00
R5709:Sbno2	UTSW	10	80086337	start codon destroyed	probably null	0.89
R5828:Sbno2	UTSW	10	80066590	missense	possibly damaging	0.84
R6192:Sbno2	UTSW	10	80060016	missense	probably damaging	0.99
R6971:Sbno2	UTSW	10	80060034	missense	possibly damaging	0.95
R7012:Sbno2	UTSW	10	80069518	intron	probably benign
R7082:Sbno2	UTSW	10	80060090	splice site	probably null
R7133:Sbno2	UTSW	10	80086312	missense	probably damaging	1.00
R7438:Sbno2	UTSW	10	80069575	missense	unknown
R7481:Sbno2	UTSW	10	80057499	missense	probably benign	0.11
R7746:Sbno2	UTSW	10	80058874	missense	probably damaging	0.99
R7964:Sbno2	UTSW	10	80068351	missense	probably damaging	1.00
R8055:Sbno2	UTSW	10	80069431	missense	possibly damaging	0.81
R8221:Sbno2	UTSW	10	80070011	missense	probably benign
R8329:Sbno2	UTSW	10	80064387	missense	probably damaging	1.00
R8725:Sbno2	UTSW	10	80075256	missense	probably benign	0.09
R8727:Sbno2	UTSW	10	80075256	missense	probably benign	0.09
R8840:Sbno2	UTSW	10	80057526	missense	probably damaging	0.97
R8932:Sbno2	UTSW	10	80062208	missense	probably damaging	1.00
R8954:Sbno2	UTSW	10	80057962	missense	probably damaging	1.00
R9003:Sbno2	UTSW	10	80060215	missense	probably damaging	1.00
R9034:Sbno2	UTSW	10	80062757	missense	probably damaging	1.00
X0026:Sbno2	UTSW	10	80057459	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- GAGTGCCCTCAAGAAATCTGC -3'
(R):5'- TTTCCAGATAGGCTTGCCG -3'

Sequencing Primer
(F):5'- TCAAGAAATCTGCTCTGGGGC -3'
(R):5'- AGATAGGCTTGCCGGGAGTTG -3'

Posted On

2015-10-21