Incidental Mutation 'R4692:Mapk7'
ID354983
Institutional Source Beutler Lab
Gene Symbol Mapk7
Ensembl Gene ENSMUSG00000001034
Gene Namemitogen-activated protein kinase 7
Synonymsbig MAP kinase 1, Erk5-T, BMK1, ERK5
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61488812-61494406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61489242 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 697 (S697P)
Ref Sequence ENSEMBL: ENSMUSP00000104354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040522] [ENSMUST00000064783] [ENSMUST00000079080] [ENSMUST00000101085] [ENSMUST00000108714] [ENSMUST00000153441]
Predicted Effect probably benign
Transcript: ENSMUST00000040522
SMART Domains Protein: ENSMUSP00000038971
Gene: ENSMUSG00000042436

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 280 5.6e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064783
SMART Domains Protein: ENSMUSP00000070848
Gene: ENSMUSG00000042436

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 257 3.39e-130 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079080
AA Change: S766P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078087
Gene: ENSMUSG00000001034
AA Change: S766P

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 55 347 5.66e-96 SMART
low complexity region 433 447 N/A INTRINSIC
low complexity region 476 492 N/A INTRINSIC
coiled coil region 508 544 N/A INTRINSIC
low complexity region 578 603 N/A INTRINSIC
low complexity region 620 644 N/A INTRINSIC
low complexity region 675 692 N/A INTRINSIC
low complexity region 758 772 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101085
AA Change: S663P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098646
Gene: ENSMUSG00000001034
AA Change: S663P

DomainStartEndE-ValueType
S_TKc 4 277 3.48e-73 SMART
low complexity region 363 377 N/A INTRINSIC
coiled coil region 405 441 N/A INTRINSIC
low complexity region 475 500 N/A INTRINSIC
low complexity region 517 541 N/A INTRINSIC
low complexity region 572 589 N/A INTRINSIC
low complexity region 655 669 N/A INTRINSIC
low complexity region 688 700 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108714
AA Change: S697P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104354
Gene: ENSMUSG00000001034
AA Change: S697P

DomainStartEndE-ValueType
S_TKc 1 278 1.76e-74 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 407 423 N/A INTRINSIC
coiled coil region 439 475 N/A INTRINSIC
low complexity region 509 534 N/A INTRINSIC
low complexity region 551 575 N/A INTRINSIC
low complexity region 606 623 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140779
Predicted Effect probably benign
Transcript: ENSMUST00000153441
SMART Domains Protein: ENSMUSP00000116084
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
PDB:4IC8|B 1 49 2e-26 PDB
low complexity region 51 65 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
coiled coil region 126 162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is specifically activated by mitogen-activated protein kinase kinase 5 (MAP2K5/MEK5). It is involved in the downstream signaling processes of various receptor molecules including receptor type kinases, and G protein-coupled receptors. In response to extracelluar signals, this kinase translocates to cell nucleus, where it regulates gene expression by phosphorylating, and activating different transcription factors. Four alternatively spliced transcript variants of this gene encoding two distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth retardation and midgestational lethality due to multiple developmental anomalies and vascular remodelling, cardiac development, and placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Mapk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Mapk7 APN 11 61491160 missense probably damaging 1.00
IGL02289:Mapk7 APN 11 61489959 splice site probably null
IGL03108:Mapk7 APN 11 61491672 missense probably damaging 1.00
IGL03342:Mapk7 APN 11 61491390 missense probably damaging 1.00
FR4340:Mapk7 UTSW 11 61490206 intron probably benign
FR4589:Mapk7 UTSW 11 61490222 intron probably benign
R1497:Mapk7 UTSW 11 61493863 missense possibly damaging 0.53
R1866:Mapk7 UTSW 11 61489413 missense probably benign 0.27
R2870:Mapk7 UTSW 11 61490212 intron probably benign
R2871:Mapk7 UTSW 11 61490212 intron probably benign
R2872:Mapk7 UTSW 11 61490212 intron probably benign
R3831:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R3832:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R3833:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R4378:Mapk7 UTSW 11 61493667 missense probably damaging 1.00
R4428:Mapk7 UTSW 11 61489229 missense possibly damaging 0.90
R4642:Mapk7 UTSW 11 61490901 missense probably damaging 0.99
R4718:Mapk7 UTSW 11 61489254 missense possibly damaging 0.73
R4755:Mapk7 UTSW 11 61490843 missense probably damaging 1.00
R4916:Mapk7 UTSW 11 61493649 missense probably damaging 0.97
R4933:Mapk7 UTSW 11 61493908 unclassified probably benign
R5825:Mapk7 UTSW 11 61490381 missense possibly damaging 0.66
R5875:Mapk7 UTSW 11 61493698 missense probably benign 0.13
R5910:Mapk7 UTSW 11 61493621 start codon destroyed probably benign 0.01
R7201:Mapk7 UTSW 11 61489172 missense probably benign 0.33
R7465:Mapk7 UTSW 11 61490453 missense probably damaging 1.00
R7797:Mapk7 UTSW 11 61489415 missense possibly damaging 0.72
RF031:Mapk7 UTSW 11 61490234 intron probably benign
Z1177:Mapk7 UTSW 11 61491362 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGATGCTGGGTCTATCC -3'
(R):5'- GTTCTCTGGCACTCCAAAGG -3'

Sequencing Primer
(F):5'- TGGGTCTATCCTGGCAGCAAG -3'
(R):5'- CACTCCAAAGGGCAGTGG -3'
Posted On2015-10-21