Incidental Mutation 'R4692:Sox9'
ID354985
Institutional Source Beutler Lab
Gene Symbol Sox9
Ensembl Gene ENSMUSG00000000567
Gene NameSRY (sex determining region Y)-box 9
Synonyms2010306G03Rik
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4692 (G1)
Quality Score119
Status Not validated
Chromosome11
Chromosomal Location112782224-112787760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 112782977 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 131 (H131Q)
Ref Sequence ENSEMBL: ENSMUSP00000000579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000579]
Predicted Effect probably benign
Transcript: ENSMUST00000000579
AA Change: H131Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000000579
Gene: ENSMUSG00000000567
AA Change: H131Q

DomainStartEndE-ValueType
Pfam:Sox_N 22 94 9.6e-29 PFAM
HMG 104 174 2.34e-27 SMART
low complexity region 186 196 N/A INTRINSIC
low complexity region 234 241 N/A INTRINSIC
low complexity region 339 377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137081
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene recognizes the sequence CCTTGAG along with other members of the HMG-box class DNA-binding proteins. It acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Muellerian hormone (AMH) gene. Deficiencies lead to the skeletal malformation syndrome campomelic dysplasia, frequently with sex reversal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mutant heterozygotes and conditional knockout mutants display perinatal lethality with cleft palate, hypoplasia and distortion of numerous cartilage-derived skeletal structures, and premature mineralization in many bones. Specific conditional knockout mutations are sex-reversed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Sox9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Sox9 APN 11 112784674 missense probably benign 0.00
IGL02257:Sox9 APN 11 112784985 missense possibly damaging 0.84
IGL02935:Sox9 APN 11 112785349 missense probably damaging 0.99
R0350:Sox9 UTSW 11 112784876 missense probably damaging 0.99
R0634:Sox9 UTSW 11 112784942 missense probably damaging 0.98
R4273:Sox9 UTSW 11 112785154 missense possibly damaging 0.60
R5328:Sox9 UTSW 11 112782658 missense probably benign 0.39
R5501:Sox9 UTSW 11 112783859 missense probably damaging 1.00
R5905:Sox9 UTSW 11 112783820 missense probably damaging 1.00
R6707:Sox9 UTSW 11 112782872 missense probably damaging 0.99
R6834:Sox9 UTSW 11 112784000 missense probably benign 0.01
R7897:Sox9 UTSW 11 112784809 missense probably benign 0.22
Z1176:Sox9 UTSW 11 112785122 missense possibly damaging 0.51
Z1177:Sox9 UTSW 11 112784803 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- TAAGTTCCCCGTGTGCATCC -3'
(R):5'- GAGCAATCCCAAGAACTTTCTC -3'

Sequencing Primer
(F):5'- CCGTGTGCATCCGCGAG -3'
(R):5'- TCCCAAGAACTTTCTCAAAATCTG -3'
Posted On2015-10-21