Incidental Mutation 'R4692:Snx13'
ID354987
Institutional Source Beutler Lab
Gene Symbol Snx13
Ensembl Gene ENSMUSG00000020590
Gene Namesorting nexin 13
SynonymsRGS-PX1
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location35047186-35147479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35086918 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 126 (D126G)
Ref Sequence ENSEMBL: ENSMUSP00000038430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048519] [ENSMUST00000163677] [ENSMUST00000221272]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048519
AA Change: D126G

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038430
Gene: ENSMUSG00000020590
AA Change: D126G

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 34 51 N/A INTRINSIC
PXA 98 285 9.09e-102 SMART
coiled coil region 293 320 N/A INTRINSIC
RGS 374 514 4.63e-32 SMART
low complexity region 546 562 N/A INTRINSIC
PX 564 677 2.88e-31 SMART
Pfam:Nexin_C 793 903 1.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163677
AA Change: D126G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000130182
Gene: ENSMUSG00000020590
AA Change: D126G

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 34 51 N/A INTRINSIC
PXA 97 284 9.09e-102 SMART
coiled coil region 292 319 N/A INTRINSIC
RGS 373 513 4.63e-32 SMART
low complexity region 545 561 N/A INTRINSIC
PX 563 676 2.88e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222101
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PHOX domain- and RGS domain-containing protein that belongs to the sorting nexin (SNX) family and the regulator of G protein signaling (RGS) family. The PHOX domain is a phosphoinositide binding domain, and the SNX family members are involved in intracellular trafficking. The RGS family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. The RGS domain of this protein interacts with G alpha(s), accelerates its GTP hydrolysis, and attenuates G alpha(s)-mediated signaling. Overexpression of this protein delayes lysosomal degradation of the epidermal growth factor receptor. Because of its bifunctional role, this protein may link heterotrimeric G protein signaling and vesicular trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are growth retarded and die at midgestation with defects in neural tube closure, vasculogenesis and placental development. Mutant visceral yolk sac endoderm cells exhibit altered endocytic compartments, abundant autophagic vacuoles and mislocalization of endocytic markers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Snx13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Snx13 APN 12 35098280 missense probably damaging 1.00
IGL01143:Snx13 APN 12 35132160 missense probably damaging 0.96
IGL01446:Snx13 APN 12 35124480 nonsense probably null
IGL01519:Snx13 APN 12 35138472 unclassified probably benign
IGL01902:Snx13 APN 12 35133307 critical splice acceptor site probably null
IGL01903:Snx13 APN 12 35085969 missense probably benign 0.06
IGL02146:Snx13 APN 12 35101079 missense probably benign 0.00
IGL02175:Snx13 APN 12 35132062 missense possibly damaging 0.83
IGL02197:Snx13 APN 12 35106801 missense probably damaging 1.00
IGL02200:Snx13 APN 12 35086885 missense probably damaging 1.00
IGL02476:Snx13 APN 12 35086941 missense probably damaging 1.00
IGL03171:Snx13 APN 12 35100540 missense probably benign 0.28
jiaozhi UTSW 12 35144220 missense probably damaging 0.98
resistance UTSW 12 35112445 missense probably damaging 1.00
IGL02835:Snx13 UTSW 12 35132127 missense possibly damaging 0.48
P0042:Snx13 UTSW 12 35107542 missense probably damaging 1.00
R0047:Snx13 UTSW 12 35101124 splice site probably benign
R0047:Snx13 UTSW 12 35101124 splice site probably benign
R0344:Snx13 UTSW 12 35086900 nonsense probably null
R1240:Snx13 UTSW 12 35091406 missense probably damaging 0.99
R1335:Snx13 UTSW 12 35132124 missense probably benign 0.16
R1451:Snx13 UTSW 12 35078984 missense probably benign 0.00
R1617:Snx13 UTSW 12 35086896 missense probably damaging 0.99
R2065:Snx13 UTSW 12 35138066 missense possibly damaging 0.91
R2111:Snx13 UTSW 12 35138085 missense probably damaging 1.00
R2385:Snx13 UTSW 12 35119793 missense probably benign 0.36
R2437:Snx13 UTSW 12 35082927 missense probably benign 0.14
R2511:Snx13 UTSW 12 35138081 missense probably benign 0.13
R2860:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2861:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2862:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2992:Snx13 UTSW 12 35105191 missense probably damaging 1.00
R3938:Snx13 UTSW 12 35144097 missense probably benign 0.10
R4304:Snx13 UTSW 12 35122942 missense probably benign 0.10
R4532:Snx13 UTSW 12 35144220 missense probably damaging 0.98
R4783:Snx13 UTSW 12 35098286 missense probably damaging 1.00
R4914:Snx13 UTSW 12 35132033 missense possibly damaging 0.84
R5309:Snx13 UTSW 12 35144325 nonsense probably null
R5425:Snx13 UTSW 12 35100644 nonsense probably null
R5476:Snx13 UTSW 12 35106820 splice site probably null
R5533:Snx13 UTSW 12 35123026 critical splice donor site probably null
R5564:Snx13 UTSW 12 35124472 missense possibly damaging 0.61
R5572:Snx13 UTSW 12 35103120 missense probably damaging 1.00
R5635:Snx13 UTSW 12 35140171 missense probably benign 0.00
R6018:Snx13 UTSW 12 35047319 start gained probably benign
R6612:Snx13 UTSW 12 35106759 missense probably benign 0.19
R6618:Snx13 UTSW 12 35112445 missense probably damaging 1.00
R6737:Snx13 UTSW 12 35140186 missense probably damaging 0.98
R6964:Snx13 UTSW 12 35119789 missense possibly damaging 0.81
R7186:Snx13 UTSW 12 35092913 missense probably damaging 0.99
R7372:Snx13 UTSW 12 35078951 missense probably benign 0.00
R7429:Snx13 UTSW 12 35133358 missense possibly damaging 0.89
R7430:Snx13 UTSW 12 35133358 missense possibly damaging 0.89
R7537:Snx13 UTSW 12 35085982 missense probably damaging 1.00
R7567:Snx13 UTSW 12 35086914 missense probably damaging 1.00
R7582:Snx13 UTSW 12 35124535 nonsense probably null
R7767:Snx13 UTSW 12 35107484 missense probably damaging 1.00
R7771:Snx13 UTSW 12 35124528 missense probably benign
R7838:Snx13 UTSW 12 35105175 missense probably benign 0.26
R7901:Snx13 UTSW 12 35100625 missense probably benign 0.02
R8029:Snx13 UTSW 12 35119886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTCTGTCTGAATGTAGGTAGC -3'
(R):5'- GGCTACACAGAGAAACCCTGTC -3'

Sequencing Primer
(F):5'- CTCTGTCTGAATGTAGGTAGCCTTAG -3'
(R):5'- AACACTTCATTTGCATTTACTCAAG -3'
Posted On2015-10-21