Incidental Mutation 'R4692:Begain'
ID354988
Institutional Source Beutler Lab
Gene Symbol Begain
Ensembl Gene ENSMUSG00000040867
Gene Namebrain-enriched guanylate kinase-associated
SynonymsLOC380785
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location109032187-109068217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109033892 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 523 (S523P)
Ref Sequence ENSEMBL: ENSMUSP00000148247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000190647] [ENSMUST00000209829]
Predicted Effect probably damaging
Transcript: ENSMUST00000073156
AA Change: S318P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072899
Gene: ENSMUSG00000040867
AA Change: S318P

DomainStartEndE-ValueType
SCOP:d1fxkc_ 18 132 2e-4 SMART
low complexity region 285 306 N/A INTRINSIC
low complexity region 309 326 N/A INTRINSIC
low complexity region 445 460 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189236
Predicted Effect probably damaging
Transcript: ENSMUST00000190647
AA Change: S318P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140393
Gene: ENSMUSG00000040867
AA Change: S318P

DomainStartEndE-ValueType
SCOP:d1fxkc_ 18 132 2e-4 SMART
low complexity region 285 306 N/A INTRINSIC
low complexity region 309 326 N/A INTRINSIC
low complexity region 445 460 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209829
AA Change: S523P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Begain
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Begain APN 12 109033645 missense probably benign 0.00
IGL02027:Begain APN 12 109034309 missense possibly damaging 0.80
IGL02186:Begain APN 12 109033352 missense probably damaging 1.00
IGL02219:Begain APN 12 109033730 missense probably benign 0.01
IGL02555:Begain APN 12 109034189 missense probably damaging 1.00
FR4342:Begain UTSW 12 109033418 unclassified probably benign
R0335:Begain UTSW 12 109038934 missense probably damaging 1.00
R1815:Begain UTSW 12 109034107 missense probably damaging 1.00
R1824:Begain UTSW 12 109033099 unclassified probably null
R1837:Begain UTSW 12 109035323 splice site probably benign
R1839:Begain UTSW 12 109035323 splice site probably benign
R2110:Begain UTSW 12 109033917 nonsense probably null
R2849:Begain UTSW 12 109033118 missense probably benign 0.17
R4480:Begain UTSW 12 109034123 missense probably damaging 1.00
R6425:Begain UTSW 12 109033394 missense probably damaging 1.00
R7205:Begain UTSW 12 109038868 missense possibly damaging 0.64
R7354:Begain UTSW 12 109033289 missense possibly damaging 0.91
R7369:Begain UTSW 12 109033927 missense possibly damaging 0.51
R7683:Begain UTSW 12 109033487 missense unknown
R7755:Begain UTSW 12 109052876 missense probably benign 0.01
R7807:Begain UTSW 12 109038930 missense probably damaging 1.00
RF008:Begain UTSW 12 109033437 nonsense probably null
RF012:Begain UTSW 12 109033427 unclassified probably benign
RF014:Begain UTSW 12 109033422 unclassified probably benign
RF020:Begain UTSW 12 109033424 unclassified probably benign
RF024:Begain UTSW 12 109033437 nonsense probably null
RF025:Begain UTSW 12 109033424 unclassified probably benign
RF049:Begain UTSW 12 109033414 unclassified probably benign
RF056:Begain UTSW 12 109033436 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CACAGGTTTGGAGGCATGAG -3'
(R):5'- GAGACATCTACTGCAGCGAC -3'

Sequencing Primer
(F):5'- ACAGTCCGAGCAAAGCCTGG -3'
(R):5'- AGCGACCCAGCTCTCTACTG -3'
Posted On2015-10-21