Incidental Mutation 'R4692:9230104M06Rik'
ID354989
Institutional Source Beutler Lab
Gene Symbol 9230104M06Rik
Ensembl Gene ENSMUSG00000097100
Gene NameRIKEN cDNA 9230104M06 gene
Synonyms
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location112999963-113001925 bp (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 113000072 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000011302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011302]
Predicted Effect probably benign
Transcript: ENSMUST00000011302
SMART Domains Protein: ENSMUSP00000011302
Gene: ENSMUSG00000011158

DomainStartEndE-ValueType
Pfam:TF_Zn_Ribbon 4 46 4.3e-17 PFAM
CYCLIN 91 172 1.93e-12 SMART
CYCLIN 185 269 1.22e-9 SMART
coiled coil region 298 334 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
Pfam:BRF1 452 545 3.3e-29 PFAM
low complexity region 638 650 N/A INTRINSIC
low complexity region 662 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180971
SMART Domains Protein: ENSMUSP00000138066
Gene: ENSMUSG00000097100

DomainStartEndE-ValueType
low complexity region 40 52 N/A INTRINSIC
low complexity region 77 85 N/A INTRINSIC
low complexity region 101 115 N/A INTRINSIC
low complexity region 120 182 N/A INTRINSIC
low complexity region 189 200 N/A INTRINSIC
low complexity region 244 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223037
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in 9230104M06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:9230104M06Rik APN 12 113000175 missense probably benign 0.45
R2566:9230104M06Rik UTSW 12 113000739 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TAGAGTGGCCAACCGGATAAAC -3'
(R):5'- GGACAACATCATCGTGTCCG -3'

Sequencing Primer
(F):5'- GAAAGCCGTGCCTGTCAGATTTC -3'
(R):5'- CGTGTCCGAGGTGCAGTTC -3'
Posted On2015-10-21