Incidental Mutation 'R4692:Zscan26'
ID354990
Institutional Source Beutler Lab
Gene Symbol Zscan26
Ensembl Gene ENSMUSG00000022228
Gene Namezinc finger and SCAN domain containing 26
SynonymsZfp187
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21442180-21453730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21445257 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 359 (C359R)
Ref Sequence ENSEMBL: ENSMUSP00000106111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032820] [ENSMUST00000099719] [ENSMUST00000110485] [ENSMUST00000122872] [ENSMUST00000145494] [ENSMUST00000148071] [ENSMUST00000151743]
Predicted Effect probably damaging
Transcript: ENSMUST00000032820
AA Change: C233R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032820
Gene: ENSMUSG00000022228
AA Change: C233R

DomainStartEndE-ValueType
ZnF_C2H2 144 166 1.58e-3 SMART
ZnF_C2H2 172 194 6.99e-5 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 228 250 1.45e-2 SMART
ZnF_C2H2 256 278 2.53e-2 SMART
ZnF_C2H2 284 306 5.14e-3 SMART
ZnF_C2H2 312 334 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099719
SMART Domains Protein: ENSMUSP00000097307
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110485
AA Change: C359R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106111
Gene: ENSMUSG00000022228
AA Change: C359R

DomainStartEndE-ValueType
SCAN 38 151 1.58e-48 SMART
ZnF_C2H2 270 292 1.58e-3 SMART
ZnF_C2H2 298 320 6.99e-5 SMART
ZnF_C2H2 326 348 1.67e-2 SMART
ZnF_C2H2 354 376 1.45e-2 SMART
ZnF_C2H2 382 404 2.53e-2 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 2.95e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122641
Predicted Effect probably benign
Transcript: ENSMUST00000122872
SMART Domains Protein: ENSMUSP00000120175
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 1e-13 BLAST
low complexity region 155 167 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 213 374 1.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122926
Predicted Effect probably benign
Transcript: ENSMUST00000145494
SMART Domains Protein: ENSMUSP00000118503
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 8e-15 BLAST
low complexity region 192 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148071
SMART Domains Protein: ENSMUSP00000114882
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 3e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151743
SMART Domains Protein: ENSMUSP00000117669
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.7e-42 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Other mutations in Zscan26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Zscan26 APN 13 21445101 missense probably damaging 0.99
IGL00720:Zscan26 APN 13 21445199 missense probably benign 0.00
R0558:Zscan26 UTSW 13 21445055 missense probably benign 0.37
R1236:Zscan26 UTSW 13 21445770 missense probably benign
R1912:Zscan26 UTSW 13 21445140 missense possibly damaging 0.84
R5818:Zscan26 UTSW 13 21445761 missense probably benign 0.00
R6089:Zscan26 UTSW 13 21448329 missense probably damaging 0.97
R8029:Zscan26 UTSW 13 21445350 missense probably damaging 1.00
Z1088:Zscan26 UTSW 13 21445463 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAGACCAGACTTCTGCCTG -3'
(R):5'- AGAGAAGTTCACACCTCATCAG -3'

Sequencing Primer
(F):5'- GCGGAAAGCTTTCTGACAC -3'
(R):5'- ATCCATCTTGGGGAGAAGCCTTAC -3'
Posted On2015-10-21