Incidental Mutation 'R4692:Kif13b'
ID354991
Institutional Source Beutler Lab
Gene Symbol Kif13b
Ensembl Gene ENSMUSG00000060012
Gene Namekinesin family member 13B
SynonymsN-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location64647265-64809617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 64803575 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1704 (T1704K)
Ref Sequence ENSEMBL: ENSMUSP00000098041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]
Predicted Effect probably benign
Transcript: ENSMUST00000100473
AA Change: T1704K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012
AA Change: T1704K

DomainStartEndE-ValueType
KISc 3 361 1.4e-182 SMART
FHA 470 520 6.86e-1 SMART
low complexity region 546 560 N/A INTRINSIC
coiled coil region 617 646 N/A INTRINSIC
coiled coil region 669 701 N/A INTRINSIC
Pfam:KIF1B 756 802 4.1e-20 PFAM
Pfam:DUF3694 1003 1279 1.4e-37 PFAM
low complexity region 1514 1526 N/A INTRINSIC
low complexity region 1532 1548 N/A INTRINSIC
low complexity region 1574 1589 N/A INTRINSIC
low complexity region 1617 1630 N/A INTRINSIC
CAP_GLY 1719 1784 1.54e-29 SMART
low complexity region 1814 1826 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224503
AA Change: T1708K

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224677
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Kif13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kif13b APN 14 64669693 missense possibly damaging 0.81
IGL00485:Kif13b APN 14 64765073 missense possibly damaging 0.88
IGL00495:Kif13b APN 14 64714113 missense probably benign 0.07
IGL00556:Kif13b APN 14 64744888 missense probably damaging 1.00
IGL00571:Kif13b APN 14 64746417 missense probably damaging 0.99
IGL00590:Kif13b APN 14 64779462 missense probably damaging 1.00
IGL01650:Kif13b APN 14 64765145 missense probably benign 0.00
IGL01730:Kif13b APN 14 64750361 critical splice donor site probably null
IGL01908:Kif13b APN 14 64757558 missense probably damaging 1.00
IGL02388:Kif13b APN 14 64800358 missense probably damaging 1.00
IGL02573:Kif13b APN 14 64803431 missense probably damaging 1.00
IGL02661:Kif13b APN 14 64767691 missense probably benign 0.06
IGL02794:Kif13b APN 14 64803440 missense probably benign 0.00
IGL02959:Kif13b APN 14 64767717 missense probably damaging 1.00
IGL02979:Kif13b APN 14 64789697 missense probably damaging 0.96
IGL03114:Kif13b APN 14 64788448 missense probably benign 0.00
R0024:Kif13b UTSW 14 64750273 missense probably benign 0.30
R0330:Kif13b UTSW 14 64803220 missense probably benign
R0376:Kif13b UTSW 14 64757404 splice site probably benign
R0571:Kif13b UTSW 14 64751528 missense probably damaging 1.00
R0718:Kif13b UTSW 14 64751662 splice site probably benign
R1144:Kif13b UTSW 14 64714117 missense probably benign 0.01
R1183:Kif13b UTSW 14 64782377 missense probably benign 0.00
R1264:Kif13b UTSW 14 64776232 splice site probably benign
R1497:Kif13b UTSW 14 64736266 missense probably damaging 0.99
R1579:Kif13b UTSW 14 64782341 critical splice acceptor site probably null
R1624:Kif13b UTSW 14 64738619 missense probably damaging 0.99
R1706:Kif13b UTSW 14 64760666 splice site probably benign
R2176:Kif13b UTSW 14 64669671 missense probably benign 0.01
R3727:Kif13b UTSW 14 64765748 splice site probably benign
R3785:Kif13b UTSW 14 64800400 missense probably benign 0.00
R3786:Kif13b UTSW 14 64800400 missense probably benign 0.00
R4088:Kif13b UTSW 14 64767455 critical splice donor site probably null
R4279:Kif13b UTSW 14 64779356 missense probably damaging 1.00
R4559:Kif13b UTSW 14 64806132 missense probably damaging 0.98
R4689:Kif13b UTSW 14 64773064 missense probably damaging 1.00
R4878:Kif13b UTSW 14 64806154 missense probably benign 0.00
R4971:Kif13b UTSW 14 64757562 missense possibly damaging 0.90
R5037:Kif13b UTSW 14 64758589 nonsense probably null
R5119:Kif13b UTSW 14 64757453 missense probably benign 0.01
R5167:Kif13b UTSW 14 64772935 missense probably damaging 1.00
R5408:Kif13b UTSW 14 64779689 critical splice acceptor site probably null
R5437:Kif13b UTSW 14 64806114 missense probably damaging 0.99
R5756:Kif13b UTSW 14 64736305 missense probably damaging 1.00
R5838:Kif13b UTSW 14 64737555 missense probably damaging 1.00
R5891:Kif13b UTSW 14 64788405 splice site probably null
R6120:Kif13b UTSW 14 64751558 missense probably damaging 1.00
R6150:Kif13b UTSW 14 64751639 missense probably damaging 0.99
R6165:Kif13b UTSW 14 64742311 missense probably damaging 1.00
R6187:Kif13b UTSW 14 64736215 missense probably damaging 1.00
R6229:Kif13b UTSW 14 64738567 missense probably damaging 1.00
R6267:Kif13b UTSW 14 64738634 missense probably damaging 1.00
R6347:Kif13b UTSW 14 64767619 missense probably benign 0.26
R6479:Kif13b UTSW 14 64751525 missense probably benign 0.08
R6512:Kif13b UTSW 14 64744874 critical splice acceptor site probably null
R6851:Kif13b UTSW 14 64773065 missense probably damaging 1.00
R7131:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7217:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7398:Kif13b UTSW 14 64757523 missense probably null 0.02
R7427:Kif13b UTSW 14 64788460 missense probably benign
R7428:Kif13b UTSW 14 64788460 missense probably benign
R7573:Kif13b UTSW 14 64803658 missense probably benign 0.00
R7629:Kif13b UTSW 14 64779335 nonsense probably null
R7683:Kif13b UTSW 14 64757507 missense probably benign 0.24
R7835:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7895:Kif13b UTSW 14 64736149 missense probably damaging 1.00
R7918:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7978:Kif13b UTSW 14 64736149 missense probably damaging 1.00
Z1176:Kif13b UTSW 14 64803344 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGCAGCTCCTACTCAAAG -3'
(R):5'- CAGTCTACTTACCTGCAGGC -3'

Sequencing Primer
(F):5'- GAGGTTCCCAGAGCACCTCTTC -3'
(R):5'- AGTCTACTTACCTGCAGGCAGATC -3'
Posted On2015-10-21