Incidental Mutation 'R4692:Smgc'
ID354994
Institutional Source Beutler Lab
Gene Symbol Smgc
Ensembl Gene ENSMUSG00000047295
Gene Namesubmandibular gland protein C
SynonymsSfc21, DXImx49e, 2310010P21Rik
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location91838265-91861438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91854561 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 474 (V474A)
Ref Sequence ENSEMBL: ENSMUSP00000085915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088555] [ENSMUST00000100293] [ENSMUST00000109276] [ENSMUST00000109277] [ENSMUST00000130014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088555
AA Change: V474A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085915
Gene: ENSMUSG00000047295
AA Change: V474A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
internal_repeat_1 55 224 2.76e-22 PROSPERO
low complexity region 225 235 N/A INTRINSIC
low complexity region 256 270 N/A INTRINSIC
internal_repeat_1 294 464 2.76e-22 PROSPERO
low complexity region 563 574 N/A INTRINSIC
low complexity region 609 626 N/A INTRINSIC
low complexity region 652 667 N/A INTRINSIC
low complexity region 677 701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100293
SMART Domains Protein: ENSMUSP00000097866
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
internal_repeat_2 32 180 5.58e-9 PROSPERO
internal_repeat_1 55 224 1.24e-22 PROSPERO
low complexity region 225 235 N/A INTRINSIC
low complexity region 256 270 N/A INTRINSIC
internal_repeat_1 294 464 1.24e-22 PROSPERO
internal_repeat_2 420 569 5.58e-9 PROSPERO
low complexity region 576 593 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 644 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109276
SMART Domains Protein: ENSMUSP00000104899
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
low complexity region 101 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109277
SMART Domains Protein: ENSMUSP00000104900
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
low complexity region 72 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123935
Predicted Effect probably benign
Transcript: ENSMUST00000130014
SMART Domains Protein: ENSMUSP00000118530
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
internal_repeat_1 113 156 5.82e-16 PROSPERO
low complexity region 179 189 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
internal_repeat_1 233 276 5.82e-16 PROSPERO
low complexity region 304 319 N/A INTRINSIC
low complexity region 329 353 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132674
AA Change: V90A
SMART Domains Protein: ENSMUSP00000120578
Gene: ENSMUSG00000047295
AA Change: V90A

DomainStartEndE-ValueType
internal_repeat_1 12 37 9.28e-9 PROSPERO
low complexity region 180 191 N/A INTRINSIC
internal_repeat_1 194 219 9.28e-9 PROSPERO
low complexity region 226 243 N/A INTRINSIC
low complexity region 269 284 N/A INTRINSIC
low complexity region 294 318 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136172
AA Change: V65A
SMART Domains Protein: ENSMUSP00000119575
Gene: ENSMUSG00000047295
AA Change: V65A

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
low complexity region 155 166 N/A INTRINSIC
low complexity region 201 218 N/A INTRINSIC
low complexity region 244 259 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160242
SMART Domains Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 21 34 N/A INTRINSIC
VWD 47 198 1.31e-13 SMART
Pfam:C8 221 293 1.1e-8 PFAM
Pfam:TIL 298 353 1.6e-11 PFAM
VWD 383 545 1.58e-25 SMART
C8 577 651 8.71e-20 SMART
Pfam:TIL 654 711 2.1e-7 PFAM
Pfam:TIL 753 813 5.2e-8 PFAM
VWD 842 1005 2.36e-47 SMART
C8 1041 1115 1.84e-27 SMART
low complexity region 1220 1254 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Smgc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Smgc APN 15 91854543 splice site probably benign
IGL00835:Smgc APN 15 91844420 missense probably damaging 0.99
IGL01651:Smgc APN 15 91859788 intron probably benign
IGL01669:Smgc APN 15 91860684 missense possibly damaging 0.89
IGL01743:Smgc APN 15 91854593 missense probably benign 0.19
IGL01898:Smgc APN 15 91844524 splice site probably null
IGL03152:Smgc APN 15 91841422 missense possibly damaging 0.66
IGL03172:Smgc APN 15 91860444 missense probably damaging 0.99
IGL03352:Smgc APN 15 91860678 missense probably damaging 0.96
IGL03385:Smgc APN 15 91841978 missense possibly damaging 0.66
K7371:Smgc UTSW 15 91860255 splice site probably benign
R0090:Smgc UTSW 15 91859762 missense possibly damaging 0.91
R0125:Smgc UTSW 15 91854543 splice site probably benign
R0386:Smgc UTSW 15 91854638 missense probably benign 0.07
R0684:Smgc UTSW 15 91841467 unclassified probably benign
R1187:Smgc UTSW 15 91860600 missense probably damaging 0.99
R1586:Smgc UTSW 15 91838393 missense possibly damaging 0.90
R1848:Smgc UTSW 15 91859758 missense possibly damaging 0.58
R1964:Smgc UTSW 15 91860270 missense probably damaging 1.00
R2144:Smgc UTSW 15 91844421 missense possibly damaging 0.81
R3499:Smgc UTSW 15 91842003 missense possibly damaging 0.66
R3842:Smgc UTSW 15 91860262 splice site probably benign
R3978:Smgc UTSW 15 91860348 missense probably damaging 0.99
R4173:Smgc UTSW 15 91860561 missense possibly damaging 0.95
R4761:Smgc UTSW 15 91845514 missense possibly damaging 0.66
R4794:Smgc UTSW 15 91841454 missense probably benign 0.27
R4801:Smgc UTSW 15 91854616 missense probably benign 0.01
R4802:Smgc UTSW 15 91854616 missense probably benign 0.01
R5621:Smgc UTSW 15 91844420 missense probably damaging 0.99
R5672:Smgc UTSW 15 91841905 missense possibly damaging 0.46
R5707:Smgc UTSW 15 91860663 missense possibly damaging 0.66
R5722:Smgc UTSW 15 91841906 missense possibly damaging 0.83
R6212:Smgc UTSW 15 91850627 intron probably benign
R6767:Smgc UTSW 15 91841398 missense possibly damaging 0.46
R7049:Smgc UTSW 15 91860378 missense possibly damaging 0.82
R7155:Smgc UTSW 15 91852608 missense possibly damaging 0.66
R7210:Smgc UTSW 15 91860294 missense probably damaging 0.99
R7448:Smgc UTSW 15 91845493 missense probably benign 0.02
R7474:Smgc UTSW 15 91860694 missense possibly damaging 0.92
R7890:Smgc UTSW 15 91847076 missense possibly damaging 0.46
R8115:Smgc UTSW 15 91849119 critical splice donor site probably null
Z1177:Smgc UTSW 15 91856621 missense unknown
Z1177:Smgc UTSW 15 91856626 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCTACATCCAGGGCCTTGG -3'
(R):5'- CCAGACTCTACAACTGGGATAAG -3'

Sequencing Primer
(F):5'- TACATCCAGGGCCTTGGTTCAAG -3'
(R):5'- CTCTACAACTGGGATAAGAAGCAAAG -3'
Posted On2015-10-21