Mutagenetix > Incidental Mutation

Incidental Mutation 'R4692:Speer2'

354996

Institutional Source

Beutler Lab

Gene Symbol

Speer2

Ensembl Gene

ENSMUSG00000063163

Gene Name

spermatogenesis associated glutamate (E)-rich protein 2

Synonyms

SPEER-2

MMRRC Submission

041943-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R4692 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69856874-69863744 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 69857972 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 202 (T202S)

Ref Sequence

ENSEMBL: ENSMUSP00000075821 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076500] [ENSMUST00000164146] [ENSMUST00000166256]

AlphaFold

E9Q9U2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076500
AA Change: T202S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000075821
Gene: ENSMUSG00000063163
AA Change: T202S

Domain	Start	End	E-Value	Type
Pfam:Takusan	51	137	6.3e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164146

SMART Domains

Protein: ENSMUSP00000126059
Gene: ENSMUSG00000063163

Domain	Start	End	E-Value	Type
Pfam:Takusan	33	121	1.9e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166256

SMART Domains

Protein: ENSMUSP00000130270
Gene: ENSMUSG00000063163

Domain	Start	End	E-Value	Type
Pfam:Takusan	1	49	2.3e-14	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	A	T	10: 28,973,886	Y230*	probably null	Het
9230104M06Rik	A	T	12: 113,000,072		probably benign	Het
Arhgap20	A	G	9: 51,785,788	D53G	probably damaging	Het
Arl2	T	C	19: 6,137,746	T54A	probably damaging	Het
Baz2a	G	A	10: 128,124,893	G1521S	probably damaging	Het
Begain	A	G	12: 109,033,892	S523P	probably damaging	Het
Car10	T	C	11: 93,185,158		probably null	Het
Cenpe	A	G	3: 135,216,379	I66V	probably benign	Het
Col14a1	T	A	15: 55,423,468	V895E	unknown	Het
Coro1b	T	C	19: 4,149,419	Y26H	probably damaging	Het
Crebbp	T	C	16: 4,114,863	E1017G	possibly damaging	Het
Cwf19l2	T	C	9: 3,428,709	S232P	probably damaging	Het
Cyp7b1	T	A	3: 18,072,564	I473F	probably damaging	Het
D430042O09Rik	T	C	7: 125,867,669		probably null	Het
Efcab5	A	T	11: 77,113,681	I937N	probably damaging	Het
Fam53c	A	C	18: 34,768,690	E220A	probably damaging	Het
Gsn	A	G	2: 35,298,871	Y434C	probably damaging	Het
Igkv2-137	T	C	6: 67,555,987	S45P	possibly damaging	Het
Kif13b	C	A	14: 64,803,575	T1704K	probably benign	Het
Mapk7	A	G	11: 61,489,242	S697P	possibly damaging	Het
Mrgpra1	T	A	7: 47,335,698	I78F	probably damaging	Het
N6amt1	T	C	16: 87,356,966	V97A	possibly damaging	Het
Oas3	T	C	5: 120,769,355	T406A	probably benign	Het
Olfr1314	A	G	2: 112,092,681	S7P	probably damaging	Het
Olfr895	C	T	9: 38,268,530	Q6*	probably null	Het
Paxip1	T	C	5: 27,772,097		probably benign	Het
Pfn4	A	T	12: 4,774,486	Y71F	probably damaging	Het
Plin4	C	A	17: 56,103,762	G1090C	probably damaging	Het
Ptk2b	C	T	14: 66,157,069	G859S	probably benign	Het
Rbl2	T	A	8: 91,122,419	D1084E	probably damaging	Het
Robo1	T	G	16: 72,960,202	S350R	probably damaging	Het
Sbno2	A	G	10: 80,086,327	V4A	possibly damaging	Het
Sh3rf1	T	C	8: 61,353,854		probably null	Het
Smgc	T	C	15: 91,854,561	V474A	possibly damaging	Het
Snx13	A	G	12: 35,086,918	D126G	possibly damaging	Het
Sox9	C	A	11: 112,782,977	H131Q	probably benign	Het
Spag6	T	C	2: 18,699,243	I34T	probably benign	Het
Sspo	T	A	6: 48,482,687	C3327S	probably damaging	Het
Vcpip1	G	T	1: 9,748,074	A28E	unknown	Het
Vstm5	A	T	9: 15,257,422	D94V	probably damaging	Het
Zfp329	T	C	7: 12,810,632	K322E	probably damaging	Het
Zfp932	G	A	5: 110,009,186	G250D	probably damaging	Het
Zscan26	A	G	13: 21,445,257	C359R	probably damaging	Het

Other mutations in Speer2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Speer2	APN	16	69860518	missense	probably benign	0.01
IGL01115:Speer2	APN	16	69861651	nonsense	probably null
IGL01694:Speer2	APN	16	69858112	missense	probably damaging	0.98
IGL01694:Speer2	APN	16	69858113	missense	probably damaging	1.00
IGL02738:Speer2	APN	16	69861712	missense	probably benign
IGL03024:Speer2	APN	16	69858115	missense	possibly damaging	0.95
IGL03062:Speer2	APN	16	69857977	missense	probably damaging	0.96
R0054:Speer2	UTSW	16	69858752	missense	probably damaging	0.99
R1248:Speer2	UTSW	16	69857067	splice site	probably null
R1952:Speer2	UTSW	16	69857164	missense	probably damaging	0.96
R1993:Speer2	UTSW	16	69858077	missense	probably benign	0.01
R1995:Speer2	UTSW	16	69858077	missense	probably benign	0.01
R2063:Speer2	UTSW	16	69860497	missense	probably benign	0.02
R2155:Speer2	UTSW	16	69860597	missense	possibly damaging	0.63
R2216:Speer2	UTSW	16	69858842	missense	possibly damaging	0.94
R4547:Speer2	UTSW	16	69858849	missense	probably damaging	0.98
R4548:Speer2	UTSW	16	69858849	missense	probably damaging	0.98
R4625:Speer2	UTSW	16	69858754	nonsense	probably null
R4841:Speer2	UTSW	16	69858100	missense	probably benign	0.26
R4842:Speer2	UTSW	16	69858100	missense	probably benign	0.26
R5035:Speer2	UTSW	16	69857941	critical splice donor site	probably null
R5133:Speer2	UTSW	16	69858820	missense	probably null	0.06
R5812:Speer2	UTSW	16	69858895	missense	possibly damaging	0.82
R6348:Speer2	UTSW	16	69858007	missense	possibly damaging	0.83
R6854:Speer2	UTSW	16	69858887	missense	probably damaging	0.96
R7446:Speer2	UTSW	16	69858077	missense	possibly damaging	0.82
R8068:Speer2	UTSW	16	69860524	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- TTCTCACAAGAGGCTAACTTCC -3'
(R):5'- GCTGCAGGATCTTACTATGCAG -3'

Sequencing Primer
(F):5'- GAGGCTAACTTCCCAGAATATGTGTG -3'
(R):5'- CAGGATCTTACTATGCAGAGGGTG -3'

Posted On

2015-10-21