Incidental Mutation 'R4692:N6amt1'
ID354998
Institutional Source Beutler Lab
Gene Symbol N6amt1
Ensembl Gene ENSMUSG00000044442
Gene NameN-6 adenine-specific DNA methyltransferase 1 (putative)
SynonymsHemk2, Pred28, 5830445C04Rik
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location87354185-87368742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87356966 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 97 (V97A)
Ref Sequence ENSEMBL: ENSMUSP00000112510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054442] [ENSMUST00000118115] [ENSMUST00000118310] [ENSMUST00000120284]
Predicted Effect probably benign
Transcript: ENSMUST00000054442
AA Change: V97A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000061835
Gene: ENSMUSG00000044442
AA Change: V97A

DomainStartEndE-ValueType
Pfam:MTS 26 202 4.2e-12 PFAM
Pfam:Methyltransf_26 45 175 6.7e-15 PFAM
Pfam:Methyltransf_31 45 213 5.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118115
AA Change: V97A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113217
Gene: ENSMUSG00000044442
AA Change: V97A

DomainStartEndE-ValueType
Pfam:MTS 21 179 2e-14 PFAM
Pfam:Methyltransf_26 46 175 1.6e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118310
AA Change: V97A

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113229
Gene: ENSMUSG00000044442
AA Change: V97A

DomainStartEndE-ValueType
Pfam:MTS 20 137 1.7e-12 PFAM
Pfam:PrmA 27 123 6.9e-7 PFAM
Pfam:Methyltransf_26 45 137 2.7e-13 PFAM
Pfam:Methyltransf_25 49 138 6.9e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120284
AA Change: V97A

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112510
Gene: ENSMUSG00000044442
AA Change: V97A

DomainStartEndE-ValueType
Pfam:MTS 20 150 3.4e-12 PFAM
Pfam:PrmA 27 123 1.4e-6 PFAM
Pfam:Methyltransf_26 46 148 1.4e-12 PFAM
Pfam:Methyltransf_25 49 147 1.7e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N(6)-adenine-specific DNA methyltransferase. The encoded enzyme may be involved in the methylation of release factor I during translation termination. This enzyme is also involved in converting the arsenic metabolite monomethylarsonous acid to the less toxic dimethylarsonic acid. Alternative splicing pf this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele fail to form a primitive streak and die between E7.5 and E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in N6amt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1079:N6amt1 UTSW 16 87356198 missense probably damaging 0.98
R3028:N6amt1 UTSW 16 87362648 missense probably benign 0.00
R5324:N6amt1 UTSW 16 87354353 missense probably damaging 1.00
R5686:N6amt1 UTSW 16 87354335 missense probably damaging 1.00
R7001:N6amt1 UTSW 16 87354292 missense probably benign 0.30
R7223:N6amt1 UTSW 16 87362660 makesense probably null
R7419:N6amt1 UTSW 16 87367566 missense possibly damaging 0.63
R8084:N6amt1 UTSW 16 87354340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCGAGTTAAGAAAGCATTCCTAA -3'
(R):5'- GTCAACCGGTAACTCCAGCA -3'

Sequencing Primer
(F):5'- TAACTTTACCCCAGCAGGAGTCTG -3'
(R):5'- TCTACAGAGTGAGTTCCAGGAC -3'
Posted On2015-10-21