Incidental Mutation 'R0211:Olfr1062'
ID35500
Institutional Source Beutler Lab
Gene Symbol Olfr1062
Ensembl Gene ENSMUSG00000090059
Gene Nameolfactory receptor 1062
SynonymsGA_x6K02T2Q125-47892992-47892045, MOR185-1
MMRRC Submission 038462-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0211 (G1)
Quality Score93
Status Not validated
Chromosome2
Chromosomal Location86420399-86426749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86423107 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 190 (S190A)
Ref Sequence ENSEMBL: ENSMUSP00000149742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105213] [ENSMUST00000217481]
Predicted Effect probably damaging
Transcript: ENSMUST00000105213
AA Change: S190A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100848
Gene: ENSMUSG00000090059
AA Change: S190A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-46 PFAM
Pfam:7tm_1 41 290 2.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216166
Predicted Effect probably damaging
Transcript: ENSMUST00000217481
AA Change: S190A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,216,096 L1401P possibly damaging Het
4930503B20Rik C T 3: 146,650,496 R219H probably benign Het
Abcc9 T A 6: 142,688,984 I185F probably benign Het
Adgrf1 T C 17: 43,296,690 L100P probably damaging Het
Akt1 T C 12: 112,655,142 T407A probably damaging Het
Alk C T 17: 72,603,516 R65H probably damaging Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Arhgef12 G A 9: 42,972,004 R1411C probably damaging Het
Arnt T A 3: 95,476,149 M242K probably damaging Het
Atad5 T G 11: 80,095,647 V520G probably benign Het
Avpr1a T A 10: 122,449,469 M222K possibly damaging Het
Cbr2 T A 11: 120,730,788 I88L probably benign Het
Cc2d2a T A 5: 43,688,266 probably null Het
Ccdc51 T C 9: 109,089,373 M10T probably benign Het
Cntnap5b T A 1: 100,478,374 D1136E possibly damaging Het
Coil T A 11: 88,982,153 S447T probably damaging Het
Cryba1 T A 11: 77,718,867 Y179F probably damaging Het
Dcaf4 T A 12: 83,535,961 F277I probably damaging Het
Ddost G A 4: 138,309,602 V159M probably damaging Het
Dnajb6 T C 5: 29,785,079 probably benign Het
Dnase2a A G 8: 84,908,788 probably benign Het
Dscam T C 16: 96,716,079 I877V possibly damaging Het
Dyx1c1 A T 9: 72,961,367 R127S possibly damaging Het
Efcc1 A T 6: 87,749,154 T312S probably benign Het
Ermard A T 17: 15,021,943 Q127L probably damaging Het
F2 T C 2: 91,630,158 E329G probably damaging Het
Foxc2 T A 8: 121,116,616 M1K probably null Het
Fuz T A 7: 44,899,022 probably null Het
Ggnbp2 G A 11: 84,840,313 T325M probably damaging Het
Gm6408 T A 5: 146,483,060 F115I probably benign Het
Gm8909 T C 17: 36,168,007 T117A probably damaging Het
Gp6 C T 7: 4,373,209 probably null Het
Grin2a A G 16: 9,579,173 S1017P possibly damaging Het
Hmmr A T 11: 40,714,808 M318K probably damaging Het
Ifi205 T C 1: 174,028,428 E12G probably benign Het
Ift74 C T 4: 94,679,255 T395I probably benign Het
Ikbkap T A 4: 56,795,545 I143F probably damaging Het
Irf8 A T 8: 120,739,975 D53V probably damaging Het
Itgad A G 7: 128,204,641 Y69C probably damaging Het
Itpr2 C A 6: 146,194,613 R2084L probably benign Het
Krt4 C A 15: 101,922,782 S228I possibly damaging Het
Lpin3 A T 2: 160,898,681 D382V probably damaging Het
Ltbp3 T C 19: 5,752,143 probably null Het
Map4k3 C T 17: 80,644,841 A179T probably damaging Het
Nck1 A T 9: 100,497,767 W144R probably damaging Het
Ndufb9 A T 15: 58,939,282 Q139L possibly damaging Het
Ngfr T G 11: 95,571,912 E300A probably damaging Het
Nin T G 12: 70,014,875 T2072P probably damaging Het
Nop2 T G 6: 125,141,344 L529R probably damaging Het
Nrm T A 17: 35,864,611 L203Q probably damaging Het
Nynrin T C 14: 55,871,798 F1454S probably benign Het
Olfr1328 T A 4: 118,934,270 M191L probably benign Het
Olfr1453 T C 19: 13,028,282 T16A possibly damaging Het
Os9 A G 10: 127,121,036 V27A probably damaging Het
Osbpl9 T G 4: 109,073,124 T332P probably damaging Het
Pcdhb10 A T 18: 37,414,006 M712L probably benign Het
Pcx C T 19: 4,620,199 A935V probably damaging Het
Pdzd7 A G 19: 45,033,667 V514A possibly damaging Het
Plin4 C T 17: 56,102,242 G1326D probably damaging Het
Plxnb1 T A 9: 109,103,663 Y568* probably null Het
Pmfbp1 T A 8: 109,541,740 V973D probably benign Het
Ppp2r1b T C 9: 50,861,625 V70A probably benign Het
Prkar2b C A 12: 31,972,184 V201L probably benign Het
Rgr T G 14: 37,046,968 T37P probably damaging Het
Ripk3 A T 14: 55,787,918 L63Q probably damaging Het
Rpusd2 A G 2: 119,038,412 S439G probably benign Het
Serac1 T A 17: 6,050,060 R438S possibly damaging Het
Slc19a1 T A 10: 77,038,466 S24T possibly damaging Het
Slc6a21 A C 7: 45,288,243 T653P possibly damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spdef C T 17: 27,714,920 R309H probably damaging Het
Srp68 A T 11: 116,265,551 Y84N probably damaging Het
Syne2 A T 12: 76,097,957 Q6299L probably damaging Het
Tmem63b T A 17: 45,661,913 M652L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnk1 A G 11: 69,855,181 V306A probably damaging Het
Tnnc2 T A 2: 164,777,484 I147F probably damaging Het
Tnni3k C T 3: 155,055,344 probably benign Het
Togaram2 T A 17: 71,729,248 V911D probably damaging Het
Tyw3 T C 3: 154,587,495 N181S probably damaging Het
Unc79 T A 12: 103,072,792 S682T probably benign Het
Vps13d A G 4: 145,114,778 L2634S probably benign Het
Wasl G T 6: 24,633,893 A124E probably damaging Het
Zfp287 T C 11: 62,714,917 H388R probably damaging Het
Zfp335 T C 2: 164,907,692 T262A probably damaging Het
Zfp457 C G 13: 67,293,147 G359R probably benign Het
Zfp536 T A 7: 37,568,449 E514V probably damaging Het
Zfp872 T A 9: 22,200,173 I316N probably damaging Het
Other mutations in Olfr1062
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Olfr1062 APN 2 86422992 missense probably damaging 0.98
IGL02638:Olfr1062 APN 2 86423677 splice site probably null
IGL02863:Olfr1062 APN 2 86423113 missense probably benign 0.44
R0211:Olfr1062 UTSW 2 86423107 missense probably damaging 0.96
R1486:Olfr1062 UTSW 2 86423481 missense probably damaging 0.99
R2327:Olfr1062 UTSW 2 86422821 nonsense probably null
R3695:Olfr1062 UTSW 2 86423643 missense probably damaging 0.96
R3981:Olfr1062 UTSW 2 86422842 missense probably damaging 1.00
R4156:Olfr1062 UTSW 2 86423200 missense possibly damaging 0.67
R4860:Olfr1062 UTSW 2 86422957 missense probably damaging 1.00
R4860:Olfr1062 UTSW 2 86422957 missense probably damaging 1.00
R5024:Olfr1062 UTSW 2 86423461 missense possibly damaging 0.77
R5351:Olfr1062 UTSW 2 86423266 missense probably damaging 1.00
R5566:Olfr1062 UTSW 2 86423377 nonsense probably null
R5777:Olfr1062 UTSW 2 86423325 missense probably benign 0.00
R6628:Olfr1062 UTSW 2 86423017 missense probably benign 0.02
R7039:Olfr1062 UTSW 2 86422833 missense possibly damaging 0.48
R7159:Olfr1062 UTSW 2 86423612 splice site probably null
R7236:Olfr1062 UTSW 2 86423189 nonsense probably null
R7251:Olfr1062 UTSW 2 86423596 missense probably benign 0.45
R7575:Olfr1062 UTSW 2 86423238 missense probably benign
R7840:Olfr1062 UTSW 2 86423239 missense probably benign 0.00
R8048:Olfr1062 UTSW 2 86423307 missense probably damaging 1.00
R8167:Olfr1062 UTSW 2 86423140 missense probably damaging 1.00
R8465:Olfr1062 UTSW 2 86423631 missense probably benign 0.03
R8672:Olfr1062 UTSW 2 86423632 missense probably benign
R8871:Olfr1062 UTSW 2 86423353 missense probably benign
X0065:Olfr1062 UTSW 2 86423122 missense probably benign 0.39
Z1176:Olfr1062 UTSW 2 86423374 missense probably benign 0.07
Z1177:Olfr1062 UTSW 2 86423253 missense probably damaging 1.00
Z1177:Olfr1062 UTSW 2 86423412 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGTGTGCCATAGAACACAGTGACAG -3'
(R):5'- GCGGTCATCAACTTTGGCAACTC -3'

Sequencing Primer
(F):5'- TAGAACACAGTGACAGCCATC -3'
(R):5'- TACTATGAATGTGCCACGCAG -3'
Posted On2013-05-09