Incidental Mutation 'R4692:Coro1b'
ID355002
Institutional Source Beutler Lab
Gene Symbol Coro1b
Ensembl Gene ENSMUSG00000024835
Gene Namecoronin, actin binding protein 1B
Synonymscoronin 2
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4692 (G1)
Quality Score215
Status Not validated
Chromosome19
Chromosomal Location4148619-4154035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4149419 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 26 (Y26H)
Ref Sequence ENSEMBL: ENSMUSP00000118450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008893] [ENSMUST00000096338] [ENSMUST00000123874]
Predicted Effect probably damaging
Transcript: ENSMUST00000008893
AA Change: Y26H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000008893
Gene: ENSMUSG00000024835
AA Change: Y26H

DomainStartEndE-ValueType
DUF1899 5 69 1.48e-37 SMART
WD40 68 111 2.1e-7 SMART
WD40 121 161 1.44e-5 SMART
WD40 164 204 4.08e-5 SMART
DUF1900 258 392 6.41e-88 SMART
coiled coil region 445 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096338
SMART Domains Protein: ENSMUSP00000094062
Gene: ENSMUSG00000044724

DomainStartEndE-ValueType
Pfam:7tm_1 47 295 7e-19 PFAM
low complexity region 347 361 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123874
AA Change: Y26H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118450
Gene: ENSMUSG00000024835
AA Change: Y26H

DomainStartEndE-ValueType
DUF1899 5 69 1.48e-37 SMART
WD40 68 111 2.1e-7 SMART
WD40 121 161 1.44e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148733
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the coronin family, such as CORO1B, are WD repeat-containing actin-binding proteins that regulate cell motility (Cai et al., 2005 [PubMed 16027158]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal mast cell degranulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Coro1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02986:Coro1b APN 19 4149471 missense possibly damaging 0.93
IGL03411:Coro1b APN 19 4150226 splice site probably benign
R0189:Coro1b UTSW 19 4153251 missense probably damaging 1.00
R0410:Coro1b UTSW 19 4149363 missense probably damaging 1.00
R1165:Coro1b UTSW 19 4149902 missense probably damaging 0.99
R1302:Coro1b UTSW 19 4149377 missense probably damaging 1.00
R1519:Coro1b UTSW 19 4150584 missense possibly damaging 0.95
R4085:Coro1b UTSW 19 4153619 missense probably benign 0.02
R4528:Coro1b UTSW 19 4149981 missense probably benign 0.23
R4919:Coro1b UTSW 19 4150710 missense possibly damaging 0.85
R5433:Coro1b UTSW 19 4153450 missense probably benign
R5650:Coro1b UTSW 19 4150611 missense possibly damaging 0.57
R5870:Coro1b UTSW 19 4149385 missense probably damaging 1.00
R6862:Coro1b UTSW 19 4150771 missense probably benign 0.32
R7332:Coro1b UTSW 19 4149357 missense probably benign 0.00
R7511:Coro1b UTSW 19 4152526 missense probably damaging 1.00
R7559:Coro1b UTSW 19 4150221 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGAGTGTTGGTCTGCACC -3'
(R):5'- TGTGACCAGAGTGTCCTCAG -3'

Sequencing Primer
(F):5'- ATGAGCCCTTTCTATAACTGGG -3'
(R):5'- TGACCAGAGTGTCCTCAGATGTC -3'
Posted On2015-10-21