Incidental Mutation 'R4692:Arl2'
ID355003
Institutional Source Beutler Lab
Gene Symbol Arl2
Ensembl Gene ENSMUSG00000024944
Gene NameADP-ribosylation factor-like 2
Synonyms2610009M23Rik, arf-like protein 2
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location6134374-6141406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6137746 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 54 (T54A)
Ref Sequence ENSEMBL: ENSMUSP00000025893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025893]
PDB Structure
Complex of Arl2 and PDE delta, Crystal Form 1 [X-RAY DIFFRACTION]
Complex of Arl2 and PDE delta, Crystal Form 2 (native) [X-RAY DIFFRACTION]
Complex of Arl2 and PDE delta, Crystal Form 2 (SeMet) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000025893
AA Change: T54A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025893
Gene: ENSMUSG00000024944
AA Change: T54A

DomainStartEndE-ValueType
ARF 1 180 8.03e-60 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134821
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small GTP-binding protein of the RAS superfamily which functions as an ADP-ribosylation factor (ARF). The encoded protein is one of a functionally distinct group of ARF-like genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Arl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Arl2 APN 19 6141052 missense probably damaging 1.00
IGL00841:Arl2 APN 19 6135969 splice site probably benign
IGL01883:Arl2 APN 19 6137491 missense probably damaging 1.00
R0833:Arl2 UTSW 19 6136022 missense probably damaging 1.00
R1300:Arl2 UTSW 19 6141073 missense probably benign 0.00
R3952:Arl2 UTSW 19 6134677 missense probably benign 0.03
R4669:Arl2 UTSW 19 6134686 missense probably damaging 1.00
R5683:Arl2 UTSW 19 6134764 missense probably benign
R6715:Arl2 UTSW 19 6137525 missense probably damaging 1.00
R7027:Arl2 UTSW 19 6141089 missense probably benign 0.00
R7100:Arl2 UTSW 19 6134744 missense probably benign 0.01
R8212:Arl2 UTSW 19 6137566 missense probably damaging 1.00
R8226:Arl2 UTSW 19 6137476 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCGTGCTCTCAAAGTAGTTC -3'
(R):5'- TCAGGCACGTGCTCAACTTG -3'

Sequencing Primer
(F):5'- GCTCTCAAAGTAGTTCCTCCAGTAG -3'
(R):5'- TACAGTAGGAAAGTACTAGTCCCTAG -3'
Posted On2015-10-21