Incidental Mutation 'R4693:Olfr1231'
ID355009
Institutional Source Beutler Lab
Gene Symbol Olfr1231
Ensembl Gene ENSMUSG00000075093
Gene Nameolfactory receptor 1231
SynonymsGA_x6K02T2Q125-50748233-50747292, MOR235-2
MMRRC Submission 041944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4693 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89299786-89307074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89303277 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 105 (E105V)
Ref Sequence ENSEMBL: ENSMUSP00000150310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099786] [ENSMUST00000216144]
Predicted Effect probably benign
Transcript: ENSMUST00000099786
AA Change: E105V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097374
Gene: ENSMUSG00000075093
AA Change: E105V

DomainStartEndE-ValueType
Pfam:7tm_4 32 306 7e-43 PFAM
Pfam:7tm_1 42 288 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216144
AA Change: E105V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,696,697 Y478H probably damaging Het
Adar A T 3: 89,735,940 H128L probably damaging Het
Angptl6 G T 9: 20,875,302 D349E probably damaging Het
Anxa9 T C 3: 95,297,356 T286A probably benign Het
Apobr A G 7: 126,586,847 N510S probably damaging Het
Atoh7 G T 10: 63,100,496 R114L probably benign Het
Bank1 C G 3: 136,247,676 R106P probably damaging Het
Best1 C T 19: 9,997,135 G15D probably damaging Het
Best2 A T 8: 85,011,203 F188I probably damaging Het
Ccdc88a T C 11: 29,482,241 Y344H probably damaging Het
Col6a5 A G 9: 105,937,172 L547P unknown Het
Cyp19a1 A T 9: 54,173,333 S247T possibly damaging Het
Cyp26a1 T C 19: 37,698,477 S126P probably benign Het
Dab1 G T 4: 104,679,553 C180F probably damaging Het
Dclk2 T C 3: 86,815,093 D412G possibly damaging Het
Dspp A T 5: 104,178,062 S764C unknown Het
Dync1li1 C A 9: 114,706,098 D143E probably damaging Het
Esm1 A T 13: 113,210,060 D73V probably damaging Het
Etfdh A T 3: 79,605,803 V431E probably damaging Het
Fam83c C T 2: 155,830,234 R427H probably damaging Het
Galnt9 A G 5: 110,615,509 Y93C probably damaging Het
Gm6818 G A 7: 38,400,702 noncoding transcript Het
Gm884 T A 11: 103,619,860 E427D unknown Het
Gm8979 T G 7: 106,082,378 noncoding transcript Het
Gosr2 A G 11: 103,683,929 S114P probably benign Het
Grip1 G A 10: 120,000,554 V444I probably benign Het
Haus4 G T 14: 54,549,799 A67E probably benign Het
Hectd2 T A 19: 36,614,338 probably benign Het
Kndc1 T C 7: 139,921,779 Y911H probably benign Het
Lim2 T C 7: 43,430,681 Y31H probably damaging Het
Lims2 G A 18: 31,944,499 R101H probably benign Het
Lrrc2 T A 9: 110,970,093 M236K probably damaging Het
Lrrk1 T C 7: 66,262,487 Y1775C probably damaging Het
Mdga2 A G 12: 66,797,633 V197A possibly damaging Het
Mfhas1 T A 8: 35,589,175 L268Q probably damaging Het
Mlh1 A G 9: 111,255,658 I216T probably damaging Het
Mrc2 G A 11: 105,343,702 C1016Y probably benign Het
Mvp C A 7: 126,998,328 V168F probably damaging Het
Mybphl A G 3: 108,375,178 T176A probably benign Het
Myt1 T A 2: 181,795,739 L81Q probably damaging Het
Ncbp3 T C 11: 73,075,677 L453S probably benign Het
Olfr1157 A T 2: 87,962,709 F61Y probably benign Het
Olfr1219 T C 2: 89,075,068 T8A possibly damaging Het
Olfr1456-ps1 C A 19: 13,078,862 noncoding transcript Het
Olfr545 T A 7: 102,494,452 I108F probably damaging Het
Pak4 A T 7: 28,564,249 M354K probably damaging Het
Pax3 T C 1: 78,196,746 T2A probably benign Het
Pcdh17 A G 14: 84,533,520 D1146G probably damaging Het
Pcyt1a T C 16: 32,470,224 probably benign Het
Pfkp C T 13: 6,600,635 G467D possibly damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Pth1r A G 9: 110,731,624 V25A probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Ptprf T A 4: 118,211,022 E1772D probably benign Het
Sall2 T C 14: 52,314,478 H420R probably damaging Het
Sbds G A 5: 130,250,975 R63W probably damaging Het
Sccpdh A G 1: 179,668,410 T19A possibly damaging Het
Scn8a A T 15: 101,015,691 D988V probably damaging Het
Slamf6 C T 1: 171,934,113 Q34* probably null Het
Slc22a6 T A 19: 8,623,652 I403N probably damaging Het
Sox5 T C 6: 143,835,316 Y574C probably damaging Het
Sptbn5 T A 2: 120,059,416 probably benign Het
Srcap T A 7: 127,538,544 V1022E probably damaging Het
Tbx3 G A 5: 119,677,570 E292K possibly damaging Het
Tbx5 A T 5: 119,841,899 H170L probably damaging Het
Tcf12 A T 9: 71,868,967 probably benign Het
Themis G A 10: 28,782,651 R558H probably damaging Het
Tiam1 T C 16: 89,843,282 E849G possibly damaging Het
Vav3 A G 3: 109,563,218 probably benign Het
Vmn2r90 T A 17: 17,733,694 C707S possibly damaging Het
Vmn2r96 T G 17: 18,583,008 N201K probably benign Het
Zfp148 C T 16: 33,468,135 R207C probably damaging Het
Zfp648 G T 1: 154,204,406 A104S probably benign Het
Other mutations in Olfr1231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr1231 APN 2 89303472 missense possibly damaging 0.90
IGL02189:Olfr1231 APN 2 89303297 missense probably damaging 1.00
IGL02354:Olfr1231 APN 2 89303182 missense probably benign 0.03
IGL02361:Olfr1231 APN 2 89303182 missense probably benign 0.03
PIT4305001:Olfr1231 UTSW 2 89303383 missense probably benign 0.05
R0973:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R0973:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R0974:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R2006:Olfr1231 UTSW 2 89302816 missense possibly damaging 0.60
R3150:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3177:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3277:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3409:Olfr1231 UTSW 2 89303373 missense probably benign
R4208:Olfr1231 UTSW 2 89302926 missense probably damaging 1.00
R4412:Olfr1231 UTSW 2 89303340 missense probably benign 0.00
R4697:Olfr1231 UTSW 2 89302902 missense possibly damaging 0.90
R4697:Olfr1231 UTSW 2 89302903 missense probably damaging 1.00
R5411:Olfr1231 UTSW 2 89303576 missense probably benign
R5992:Olfr1231 UTSW 2 89303359 missense possibly damaging 0.50
R6894:Olfr1231 UTSW 2 89303493 missense probably damaging 1.00
R8017:Olfr1231 UTSW 2 89303251 missense possibly damaging 0.94
R8019:Olfr1231 UTSW 2 89303251 missense possibly damaging 0.94
X0064:Olfr1231 UTSW 2 89302902 missense possibly damaging 0.72
X0067:Olfr1231 UTSW 2 89303154 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGACATTGGGGCCACAGAAG -3'
(R):5'- ACCGTGTTGGCTAATCTGCTC -3'

Sequencing Primer
(F):5'- GCCACAGAAGGGCAGATTAATC -3'
(R):5'- GTTGGCTAATCTGCTCATTGTC -3'
Posted On2015-10-21