Mutagenetix > Incidental Mutation

Incidental Mutation 'R4693:Mybphl'

355017

Institutional Source

Beutler Lab

Gene Symbol

Mybphl

Ensembl Gene

ENSMUSG00000068745

Gene Name

myosin binding protein H-like

Synonyms

MMRRC Submission

041944-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R4693 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108364911-108380057 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108375178 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 176 (T176A)

Ref Sequence

ENSEMBL: ENSMUSP00000088051 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090563]

AlphaFold

Q5FW53

Predicted Effect

probably benign
Transcript: ENSMUST00000090563
AA Change: T176A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000088051
Gene: ENSMUSG00000068745
AA Change: T176A

Domain	Start	End	E-Value	Type
IG	61	144	4.67e-4	SMART
FN3	147	229	1.62e-10	SMART
IG	268	352	3.68e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142833

Meta Mutation Damage Score

0.1593

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two immunoglobulin superfamily domains and a fibronectin 3 domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg8	T	C	17: 84,696,697	Y478H	probably damaging	Het
Adar	A	T	3: 89,735,940	H128L	probably damaging	Het
Angptl6	G	T	9: 20,875,302	D349E	probably damaging	Het
Anxa9	T	C	3: 95,297,356	T286A	probably benign	Het
Apobr	A	G	7: 126,586,847	N510S	probably damaging	Het
Atoh7	G	T	10: 63,100,496	R114L	probably benign	Het
Bank1	C	G	3: 136,247,676	R106P	probably damaging	Het
Best1	C	T	19: 9,997,135	G15D	probably damaging	Het
Best2	A	T	8: 85,011,203	F188I	probably damaging	Het
Ccdc88a	T	C	11: 29,482,241	Y344H	probably damaging	Het
Col6a5	A	G	9: 105,937,172	L547P	unknown	Het
Cyp19a1	A	T	9: 54,173,333	S247T	possibly damaging	Het
Cyp26a1	T	C	19: 37,698,477	S126P	probably benign	Het
Dab1	G	T	4: 104,679,553	C180F	probably damaging	Het
Dclk2	T	C	3: 86,815,093	D412G	possibly damaging	Het
Dspp	A	T	5: 104,178,062	S764C	unknown	Het
Dync1li1	C	A	9: 114,706,098	D143E	probably damaging	Het
Esm1	A	T	13: 113,210,060	D73V	probably damaging	Het
Etfdh	A	T	3: 79,605,803	V431E	probably damaging	Het
Fam83c	C	T	2: 155,830,234	R427H	probably damaging	Het
Galnt9	A	G	5: 110,615,509	Y93C	probably damaging	Het
Gm6818	G	A	7: 38,400,702		noncoding transcript	Het
Gm884	T	A	11: 103,619,860	E427D	unknown	Het
Gm8979	T	G	7: 106,082,378		noncoding transcript	Het
Gosr2	A	G	11: 103,683,929	S114P	probably benign	Het
Grip1	G	A	10: 120,000,554	V444I	probably benign	Het
Haus4	G	T	14: 54,549,799	A67E	probably benign	Het
Hectd2	T	A	19: 36,614,338		probably benign	Het
Kndc1	T	C	7: 139,921,779	Y911H	probably benign	Het
Lim2	T	C	7: 43,430,681	Y31H	probably damaging	Het
Lims2	G	A	18: 31,944,499	R101H	probably benign	Het
Lrrc2	T	A	9: 110,970,093	M236K	probably damaging	Het
Lrrk1	T	C	7: 66,262,487	Y1775C	probably damaging	Het
Mdga2	A	G	12: 66,797,633	V197A	possibly damaging	Het
Mfhas1	T	A	8: 35,589,175	L268Q	probably damaging	Het
Mlh1	A	G	9: 111,255,658	I216T	probably damaging	Het
Mrc2	G	A	11: 105,343,702	C1016Y	probably benign	Het
Mvp	C	A	7: 126,998,328	V168F	probably damaging	Het
Myt1	T	A	2: 181,795,739	L81Q	probably damaging	Het
Ncbp3	T	C	11: 73,075,677	L453S	probably benign	Het
Olfr1157	A	T	2: 87,962,709	F61Y	probably benign	Het
Olfr1219	T	C	2: 89,075,068	T8A	possibly damaging	Het
Olfr1231	T	A	2: 89,303,277	E105V	probably benign	Het
Olfr1456-ps1	C	A	19: 13,078,862		noncoding transcript	Het
Olfr545	T	A	7: 102,494,452	I108F	probably damaging	Het
Pak4	A	T	7: 28,564,249	M354K	probably damaging	Het
Pax3	T	C	1: 78,196,746	T2A	probably benign	Het
Pcdh17	A	G	14: 84,533,520	D1146G	probably damaging	Het
Pcyt1a	T	C	16: 32,470,224		probably benign	Het
Pfkp	C	T	13: 6,600,635	G467D	possibly damaging	Het
Plin4	C	A	17: 56,103,762	G1090C	probably damaging	Het
Pth1r	A	G	9: 110,731,624	V25A	probably damaging	Het
Ptk2b	C	T	14: 66,157,069	G859S	probably benign	Het
Ptprf	T	A	4: 118,211,022	E1772D	probably benign	Het
Sall2	T	C	14: 52,314,478	H420R	probably damaging	Het
Sbds	G	A	5: 130,250,975	R63W	probably damaging	Het
Sccpdh	A	G	1: 179,668,410	T19A	possibly damaging	Het
Scn8a	A	T	15: 101,015,691	D988V	probably damaging	Het
Slamf6	C	T	1: 171,934,113	Q34*	probably null	Het
Slc22a6	T	A	19: 8,623,652	I403N	probably damaging	Het
Sox5	T	C	6: 143,835,316	Y574C	probably damaging	Het
Sptbn5	T	A	2: 120,059,416		probably benign	Het
Srcap	T	A	7: 127,538,544	V1022E	probably damaging	Het
Tbx3	G	A	5: 119,677,570	E292K	possibly damaging	Het
Tbx5	A	T	5: 119,841,899	H170L	probably damaging	Het
Tcf12	A	T	9: 71,868,967		probably benign	Het
Themis	G	A	10: 28,782,651	R558H	probably damaging	Het
Tiam1	T	C	16: 89,843,282	E849G	possibly damaging	Het
Vav3	A	G	3: 109,563,218		probably benign	Het
Vmn2r90	T	A	17: 17,733,694	C707S	possibly damaging	Het
Vmn2r96	T	G	17: 18,583,008	N201K	probably benign	Het
Zfp148	C	T	16: 33,468,135	R207C	probably damaging	Het
Zfp648	G	T	1: 154,204,406	A104S	probably benign	Het

Other mutations in Mybphl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03365:Mybphl	APN	3	108364998	start codon destroyed	probably null	0.98
IGL03389:Mybphl	APN	3	108375718	missense	probably benign	0.09
R0194:Mybphl	UTSW	3	108374168	missense	probably benign	0.01
R0206:Mybphl	UTSW	3	108375415	missense	probably damaging	1.00
R0206:Mybphl	UTSW	3	108375415	missense	probably damaging	1.00
R0208:Mybphl	UTSW	3	108375415	missense	probably damaging	1.00
R1067:Mybphl	UTSW	3	108365003	missense	probably benign
R1223:Mybphl	UTSW	3	108375196	missense	possibly damaging	0.81
R1748:Mybphl	UTSW	3	108375084	critical splice acceptor site	probably null
R2013:Mybphl	UTSW	3	108375402	missense	probably benign	0.02
R2102:Mybphl	UTSW	3	108375633	missense	possibly damaging	0.82
R2121:Mybphl	UTSW	3	108375176	missense	probably damaging	1.00
R2197:Mybphl	UTSW	3	108377319	missense	probably damaging	1.00
R2265:Mybphl	UTSW	3	108365001	missense	probably damaging	1.00
R2266:Mybphl	UTSW	3	108365001	missense	probably damaging	1.00
R2267:Mybphl	UTSW	3	108365001	missense	probably damaging	1.00
R2268:Mybphl	UTSW	3	108365001	missense	probably damaging	1.00
R4551:Mybphl	UTSW	3	108374163	missense	possibly damaging	0.49
R4570:Mybphl	UTSW	3	108365031	missense	possibly damaging	0.61
R5759:Mybphl	UTSW	3	108374754	missense	probably benign	0.30
R7017:Mybphl	UTSW	3	108374838	missense	probably damaging	0.99
R7526:Mybphl	UTSW	3	108374180	missense	probably benign	0.00
R8266:Mybphl	UTSW	3	108377360	missense	probably damaging	1.00
R8976:Mybphl	UTSW	3	108365018	missense	probably damaging	1.00
R9440:Mybphl	UTSW	3	108374886	missense	probably benign	0.19
R9617:Mybphl	UTSW	3	108375636	missense	possibly damaging	0.68
R9655:Mybphl	UTSW	3	108374783	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTATCCCAGAGAGTCTCAGACAC -3'
(R):5'- TGACACGTGTGAGACACCTG -3'

Sequencing Primer
(F):5'- TCTCAGACACGGTGGTAGG -3'
(R):5'- GCCAGAAGATCATCCAGA -3'

Posted On

2015-10-21