Incidental Mutation 'R4693:Ptprf'
ID355022
Institutional Source Beutler Lab
Gene Symbol Ptprf
Ensembl Gene ENSMUSG00000033295
Gene Nameprotein tyrosine phosphatase, receptor type, F
SynonymsRPTP-LAR, LAR
MMRRC Submission 041944-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock #R4693 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118208213-118291405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118211022 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1772 (E1772D)
Ref Sequence ENSEMBL: ENSMUSP00000039368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049074]
PDB Structure
Tandem Ig domains of tyrosine phosphatase LAR [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049074
AA Change: E1772D

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: E1772D

DomainStartEndE-ValueType
IGc2 45 114 2.64e-12 SMART
IGc2 147 214 1.48e-15 SMART
IG 238 316 1.06e-11 SMART
FN3 319 398 6.9e-14 SMART
FN3 414 497 5.73e-11 SMART
FN3 512 591 4.06e-11 SMART
FN3 606 693 8.69e-11 SMART
FN3 709 797 8.83e-12 SMART
FN3 812 892 3.2e-9 SMART
FN3 907 988 2.53e-12 SMART
FN3 1003 1079 3.48e-1 SMART
coiled coil region 1146 1175 N/A INTRINSIC
transmembrane domain 1253 1275 N/A INTRINSIC
PTPc 1342 1600 1.12e-138 SMART
PTPc 1629 1891 3.4e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123484
Predicted Effect unknown
Transcript: ENSMUST00000124758
AA Change: E1205D
SMART Domains Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295
AA Change: E1205D

DomainStartEndE-ValueType
FN3 37 116 4.06e-11 SMART
FN3 132 220 8.83e-12 SMART
FN3 235 315 3.2e-9 SMART
FN3 330 411 2.53e-12 SMART
FN3 426 502 3.48e-1 SMART
coiled coil region 568 597 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
PTPc 776 1034 1.12e-138 SMART
PTPc 1063 1325 3.4e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127616
Predicted Effect unknown
Transcript: ENSMUST00000150096
AA Change: E1164D
SMART Domains Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: E1164D

DomainStartEndE-ValueType
FN3 14 66 2.7e1 SMART
FN3 82 165 5.73e-11 SMART
FN3 180 259 4.06e-11 SMART
FN3 275 372 6.69e-12 SMART
FN3 385 461 2.83e-1 SMART
coiled coil region 527 556 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
PTPc 735 993 1.12e-138 SMART
PTPc 1022 1284 3.4e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184953
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,696,697 Y478H probably damaging Het
Adar A T 3: 89,735,940 H128L probably damaging Het
Angptl6 G T 9: 20,875,302 D349E probably damaging Het
Anxa9 T C 3: 95,297,356 T286A probably benign Het
Apobr A G 7: 126,586,847 N510S probably damaging Het
Atoh7 G T 10: 63,100,496 R114L probably benign Het
Bank1 C G 3: 136,247,676 R106P probably damaging Het
Best1 C T 19: 9,997,135 G15D probably damaging Het
Best2 A T 8: 85,011,203 F188I probably damaging Het
Ccdc88a T C 11: 29,482,241 Y344H probably damaging Het
Col6a5 A G 9: 105,937,172 L547P unknown Het
Cyp19a1 A T 9: 54,173,333 S247T possibly damaging Het
Cyp26a1 T C 19: 37,698,477 S126P probably benign Het
Dab1 G T 4: 104,679,553 C180F probably damaging Het
Dclk2 T C 3: 86,815,093 D412G possibly damaging Het
Dspp A T 5: 104,178,062 S764C unknown Het
Dync1li1 C A 9: 114,706,098 D143E probably damaging Het
Esm1 A T 13: 113,210,060 D73V probably damaging Het
Etfdh A T 3: 79,605,803 V431E probably damaging Het
Fam83c C T 2: 155,830,234 R427H probably damaging Het
Galnt9 A G 5: 110,615,509 Y93C probably damaging Het
Gm6818 G A 7: 38,400,702 noncoding transcript Het
Gm884 T A 11: 103,619,860 E427D unknown Het
Gm8979 T G 7: 106,082,378 noncoding transcript Het
Gosr2 A G 11: 103,683,929 S114P probably benign Het
Grip1 G A 10: 120,000,554 V444I probably benign Het
Haus4 G T 14: 54,549,799 A67E probably benign Het
Hectd2 T A 19: 36,614,338 probably benign Het
Kndc1 T C 7: 139,921,779 Y911H probably benign Het
Lim2 T C 7: 43,430,681 Y31H probably damaging Het
Lims2 G A 18: 31,944,499 R101H probably benign Het
Lrrc2 T A 9: 110,970,093 M236K probably damaging Het
Lrrk1 T C 7: 66,262,487 Y1775C probably damaging Het
Mdga2 A G 12: 66,797,633 V197A possibly damaging Het
Mfhas1 T A 8: 35,589,175 L268Q probably damaging Het
Mlh1 A G 9: 111,255,658 I216T probably damaging Het
Mrc2 G A 11: 105,343,702 C1016Y probably benign Het
Mvp C A 7: 126,998,328 V168F probably damaging Het
Mybphl A G 3: 108,375,178 T176A probably benign Het
Myt1 T A 2: 181,795,739 L81Q probably damaging Het
Ncbp3 T C 11: 73,075,677 L453S probably benign Het
Olfr1157 A T 2: 87,962,709 F61Y probably benign Het
Olfr1219 T C 2: 89,075,068 T8A possibly damaging Het
Olfr1231 T A 2: 89,303,277 E105V probably benign Het
Olfr1456-ps1 C A 19: 13,078,862 noncoding transcript Het
Olfr545 T A 7: 102,494,452 I108F probably damaging Het
Pak4 A T 7: 28,564,249 M354K probably damaging Het
Pax3 T C 1: 78,196,746 T2A probably benign Het
Pcdh17 A G 14: 84,533,520 D1146G probably damaging Het
Pcyt1a T C 16: 32,470,224 probably benign Het
Pfkp C T 13: 6,600,635 G467D possibly damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Pth1r A G 9: 110,731,624 V25A probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Sall2 T C 14: 52,314,478 H420R probably damaging Het
Sbds G A 5: 130,250,975 R63W probably damaging Het
Sccpdh A G 1: 179,668,410 T19A possibly damaging Het
Scn8a A T 15: 101,015,691 D988V probably damaging Het
Slamf6 C T 1: 171,934,113 Q34* probably null Het
Slc22a6 T A 19: 8,623,652 I403N probably damaging Het
Sox5 T C 6: 143,835,316 Y574C probably damaging Het
Sptbn5 T A 2: 120,059,416 probably benign Het
Srcap T A 7: 127,538,544 V1022E probably damaging Het
Tbx3 G A 5: 119,677,570 E292K possibly damaging Het
Tbx5 A T 5: 119,841,899 H170L probably damaging Het
Tcf12 A T 9: 71,868,967 probably benign Het
Themis G A 10: 28,782,651 R558H probably damaging Het
Tiam1 T C 16: 89,843,282 E849G possibly damaging Het
Vav3 A G 3: 109,563,218 probably benign Het
Vmn2r90 T A 17: 17,733,694 C707S possibly damaging Het
Vmn2r96 T G 17: 18,583,008 N201K probably benign Het
Zfp148 C T 16: 33,468,135 R207C probably damaging Het
Zfp648 G T 1: 154,204,406 A104S probably benign Het
Other mutations in Ptprf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ptprf APN 4 118223220 splice site probably benign
IGL01337:Ptprf APN 4 118236291 missense probably damaging 1.00
IGL01482:Ptprf APN 4 118212454 missense probably damaging 1.00
IGL01743:Ptprf APN 4 118248898 critical splice donor site probably null
IGL01987:Ptprf APN 4 118277370 missense probably benign
IGL02189:Ptprf APN 4 118213642 splice site probably benign
IGL03067:Ptprf APN 4 118210713 missense possibly damaging 0.67
PIT4677001:Ptprf UTSW 4 118213612 missense probably damaging 1.00
R0382:Ptprf UTSW 4 118223394 splice site probably benign
R0788:Ptprf UTSW 4 118226466 missense probably damaging 0.97
R1164:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R1478:Ptprf UTSW 4 118212105 nonsense probably null
R1483:Ptprf UTSW 4 118235964 missense possibly damaging 0.81
R1611:Ptprf UTSW 4 118236233 missense probably benign 0.34
R1721:Ptprf UTSW 4 118224899 missense possibly damaging 0.56
R1817:Ptprf UTSW 4 118223265 missense probably benign 0.02
R1818:Ptprf UTSW 4 118209871 missense probably damaging 1.00
R1860:Ptprf UTSW 4 118223932 missense probably damaging 1.00
R2208:Ptprf UTSW 4 118269172 splice site probably benign
R2406:Ptprf UTSW 4 118269304 missense possibly damaging 0.62
R2912:Ptprf UTSW 4 118248980 missense probably damaging 0.98
R3111:Ptprf UTSW 4 118211432 missense probably damaging 1.00
R3498:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3499:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3615:Ptprf UTSW 4 118237883 missense probably benign 0.04
R3616:Ptprf UTSW 4 118237883 missense probably benign 0.04
R4038:Ptprf UTSW 4 118257608 missense probably damaging 1.00
R4243:Ptprf UTSW 4 118226452 critical splice donor site probably null
R4260:Ptprf UTSW 4 118226083 missense possibly damaging 0.64
R4726:Ptprf UTSW 4 118212217 missense possibly damaging 0.86
R4746:Ptprf UTSW 4 118225039 missense possibly damaging 0.83
R4802:Ptprf UTSW 4 118210329 intron probably benign
R4857:Ptprf UTSW 4 118217197 splice site probably benign
R5071:Ptprf UTSW 4 118211999 missense probably damaging 1.00
R5221:Ptprf UTSW 4 118225108 missense probably benign 0.00
R5327:Ptprf UTSW 4 118236389 missense probably damaging 1.00
R5336:Ptprf UTSW 4 118235634 missense probably damaging 1.00
R5356:Ptprf UTSW 4 118226338 missense probably benign 0.00
R5373:Ptprf UTSW 4 118226041 missense possibly damaging 0.93
R5555:Ptprf UTSW 4 118224924 missense probably damaging 1.00
R5693:Ptprf UTSW 4 118236177 nonsense probably null
R5860:Ptprf UTSW 4 118211289 intron probably benign
R5869:Ptprf UTSW 4 118210382 missense probably damaging 1.00
R5890:Ptprf UTSW 4 118224735 missense probably benign
R5932:Ptprf UTSW 4 118211767 missense probably benign 0.10
R6028:Ptprf UTSW 4 118213629 missense probably benign 0.01
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6088:Ptprf UTSW 4 118210755 missense possibly damaging 0.68
R6089:Ptprf UTSW 4 118211084 missense probably damaging 0.99
R6108:Ptprf UTSW 4 118223256 missense probably benign 0.01
R6320:Ptprf UTSW 4 118212814 missense probably benign
R6741:Ptprf UTSW 4 118223368 missense probably benign 0.00
R6744:Ptprf UTSW 4 118236365 missense probably benign 0.00
R6750:Ptprf UTSW 4 118231731 missense probably benign 0.03
R6906:Ptprf UTSW 4 118269277 missense possibly damaging 0.95
R7021:Ptprf UTSW 4 118223904 missense probably benign 0.00
R7153:Ptprf UTSW 4 118231543 missense probably damaging 1.00
R7326:Ptprf UTSW 4 118231669 missense probably damaging 0.99
R7337:Ptprf UTSW 4 118211125 missense probably damaging 0.99
R7374:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R7375:Ptprf UTSW 4 118212814 missense probably benign
R7399:Ptprf UTSW 4 118226523 missense probably benign 0.28
R7417:Ptprf UTSW 4 118212172 missense probably damaging 1.00
R7448:Ptprf UTSW 4 118235667 missense probably benign 0.03
R7530:Ptprf UTSW 4 118212748 missense probably damaging 1.00
R7593:Ptprf UTSW 4 118212396 missense probably benign 0.00
X0067:Ptprf UTSW 4 118236026 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGGATGTTAGGTACTAGGCCC -3'
(R):5'- CCCAAAGTCCTCTGAAAGGTG -3'

Sequencing Primer
(F):5'- GTTAGGTACTAGGCCCTCTAAAC -3'
(R):5'- CAAAGTCCTCTGAAAGGTGGCATTC -3'
Posted On2015-10-21