Incidental Mutation 'R4693:Dspp'
ID355023
Institutional Source Beutler Lab
Gene Symbol Dspp
Ensembl Gene ENSMUSG00000053268
Gene Namedentin sialophosphoprotein
SynonymsDmp3, Dsp, Dpp
MMRRC Submission 041944-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4693 (G1)
Quality Score132
Status Validated
Chromosome5
Chromosomal Location104170712-104180127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104178062 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 764 (S764C)
Ref Sequence ENSEMBL: ENSMUSP00000108391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112771]
Predicted Effect unknown
Transcript: ENSMUST00000112771
AA Change: S764C
SMART Domains Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: S764C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
internal_repeat_1 82 245 2.01e-11 PROSPERO
low complexity region 247 268 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
internal_repeat_1 285 438 2.01e-11 PROSPERO
internal_repeat_2 286 369 2.15e-10 PROSPERO
internal_repeat_2 370 454 2.15e-10 PROSPERO
low complexity region 456 472 N/A INTRINSIC
low complexity region 481 944 N/A INTRINSIC
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,696,697 Y478H probably damaging Het
Adar A T 3: 89,735,940 H128L probably damaging Het
Angptl6 G T 9: 20,875,302 D349E probably damaging Het
Anxa9 T C 3: 95,297,356 T286A probably benign Het
Apobr A G 7: 126,586,847 N510S probably damaging Het
Atoh7 G T 10: 63,100,496 R114L probably benign Het
Bank1 C G 3: 136,247,676 R106P probably damaging Het
Best1 C T 19: 9,997,135 G15D probably damaging Het
Best2 A T 8: 85,011,203 F188I probably damaging Het
Ccdc88a T C 11: 29,482,241 Y344H probably damaging Het
Col6a5 A G 9: 105,937,172 L547P unknown Het
Cyp19a1 A T 9: 54,173,333 S247T possibly damaging Het
Cyp26a1 T C 19: 37,698,477 S126P probably benign Het
Dab1 G T 4: 104,679,553 C180F probably damaging Het
Dclk2 T C 3: 86,815,093 D412G possibly damaging Het
Dync1li1 C A 9: 114,706,098 D143E probably damaging Het
Esm1 A T 13: 113,210,060 D73V probably damaging Het
Etfdh A T 3: 79,605,803 V431E probably damaging Het
Fam83c C T 2: 155,830,234 R427H probably damaging Het
Galnt9 A G 5: 110,615,509 Y93C probably damaging Het
Gm6818 G A 7: 38,400,702 noncoding transcript Het
Gm884 T A 11: 103,619,860 E427D unknown Het
Gm8979 T G 7: 106,082,378 noncoding transcript Het
Gosr2 A G 11: 103,683,929 S114P probably benign Het
Grip1 G A 10: 120,000,554 V444I probably benign Het
Haus4 G T 14: 54,549,799 A67E probably benign Het
Hectd2 T A 19: 36,614,338 probably benign Het
Kndc1 T C 7: 139,921,779 Y911H probably benign Het
Lim2 T C 7: 43,430,681 Y31H probably damaging Het
Lims2 G A 18: 31,944,499 R101H probably benign Het
Lrrc2 T A 9: 110,970,093 M236K probably damaging Het
Lrrk1 T C 7: 66,262,487 Y1775C probably damaging Het
Mdga2 A G 12: 66,797,633 V197A possibly damaging Het
Mfhas1 T A 8: 35,589,175 L268Q probably damaging Het
Mlh1 A G 9: 111,255,658 I216T probably damaging Het
Mrc2 G A 11: 105,343,702 C1016Y probably benign Het
Mvp C A 7: 126,998,328 V168F probably damaging Het
Mybphl A G 3: 108,375,178 T176A probably benign Het
Myt1 T A 2: 181,795,739 L81Q probably damaging Het
Ncbp3 T C 11: 73,075,677 L453S probably benign Het
Olfr1157 A T 2: 87,962,709 F61Y probably benign Het
Olfr1219 T C 2: 89,075,068 T8A possibly damaging Het
Olfr1231 T A 2: 89,303,277 E105V probably benign Het
Olfr1456-ps1 C A 19: 13,078,862 noncoding transcript Het
Olfr545 T A 7: 102,494,452 I108F probably damaging Het
Pak4 A T 7: 28,564,249 M354K probably damaging Het
Pax3 T C 1: 78,196,746 T2A probably benign Het
Pcdh17 A G 14: 84,533,520 D1146G probably damaging Het
Pcyt1a T C 16: 32,470,224 probably benign Het
Pfkp C T 13: 6,600,635 G467D possibly damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Pth1r A G 9: 110,731,624 V25A probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Ptprf T A 4: 118,211,022 E1772D probably benign Het
Sall2 T C 14: 52,314,478 H420R probably damaging Het
Sbds G A 5: 130,250,975 R63W probably damaging Het
Sccpdh A G 1: 179,668,410 T19A possibly damaging Het
Scn8a A T 15: 101,015,691 D988V probably damaging Het
Slamf6 C T 1: 171,934,113 Q34* probably null Het
Slc22a6 T A 19: 8,623,652 I403N probably damaging Het
Sox5 T C 6: 143,835,316 Y574C probably damaging Het
Sptbn5 T A 2: 120,059,416 probably benign Het
Srcap T A 7: 127,538,544 V1022E probably damaging Het
Tbx3 G A 5: 119,677,570 E292K possibly damaging Het
Tbx5 A T 5: 119,841,899 H170L probably damaging Het
Tcf12 A T 9: 71,868,967 probably benign Het
Themis G A 10: 28,782,651 R558H probably damaging Het
Tiam1 T C 16: 89,843,282 E849G possibly damaging Het
Vav3 A G 3: 109,563,218 probably benign Het
Vmn2r90 T A 17: 17,733,694 C707S possibly damaging Het
Vmn2r96 T G 17: 18,583,008 N201K probably benign Het
Zfp148 C T 16: 33,468,135 R207C probably damaging Het
Zfp648 G T 1: 154,204,406 A104S probably benign Het
Other mutations in Dspp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Dspp APN 5 104176892 missense possibly damaging 0.95
IGL01096:Dspp APN 5 104175367 missense possibly damaging 0.92
IGL01317:Dspp APN 5 104174048 missense probably damaging 0.99
IGL02365:Dspp APN 5 104176061 missense probably damaging 1.00
IGL02387:Dspp APN 5 104175624 missense possibly damaging 0.82
IGL02406:Dspp APN 5 104177366 nonsense probably null
IGL02445:Dspp APN 5 104177097 missense probably damaging 0.99
IGL02481:Dspp APN 5 104175648 missense possibly damaging 0.94
IGL02536:Dspp APN 5 104175665 missense probably damaging 0.99
IGL02572:Dspp APN 5 104177069 missense probably damaging 0.99
IGL02677:Dspp APN 5 104175977 missense possibly damaging 0.78
IGL02709:Dspp APN 5 104177250 missense unknown
IGL02723:Dspp APN 5 104175175 missense probably benign 0.03
IGL02740:Dspp APN 5 104177238 nonsense probably null
IGL03274:Dspp APN 5 104174948 missense probably damaging 0.99
IGL03293:Dspp APN 5 104177561 missense unknown
FR4449:Dspp UTSW 5 104178388 small deletion probably benign
R0018:Dspp UTSW 5 104178230 missense unknown
R0125:Dspp UTSW 5 104178039 missense unknown
R0503:Dspp UTSW 5 104177256 missense unknown
R1709:Dspp UTSW 5 104175724 missense probably damaging 0.98
R1851:Dspp UTSW 5 104174085 critical splice donor site probably null
R2001:Dspp UTSW 5 104178559 missense unknown
R2002:Dspp UTSW 5 104178559 missense unknown
R2198:Dspp UTSW 5 104175701 missense probably benign 0.37
R2279:Dspp UTSW 5 104178384 missense unknown
R4026:Dspp UTSW 5 104177697 missense unknown
R4066:Dspp UTSW 5 104177194 missense unknown
R4632:Dspp UTSW 5 104177406 missense unknown
R4841:Dspp UTSW 5 104177186 missense unknown
R4841:Dspp UTSW 5 104177187 missense unknown
R4917:Dspp UTSW 5 104177923 missense unknown
R5008:Dspp UTSW 5 104175573 missense possibly damaging 0.66
R5015:Dspp UTSW 5 104177060 missense possibly damaging 0.46
R5214:Dspp UTSW 5 104178498 missense unknown
R5359:Dspp UTSW 5 104175886 missense probably damaging 0.98
R5538:Dspp UTSW 5 104175230 nonsense probably null
R5703:Dspp UTSW 5 104177051 missense possibly damaging 0.82
R5887:Dspp UTSW 5 104175455 missense probably damaging 1.00
R5902:Dspp UTSW 5 104178111 missense unknown
R5992:Dspp UTSW 5 104178451 missense unknown
R6019:Dspp UTSW 5 104178039 missense unknown
R6191:Dspp UTSW 5 104177348 missense unknown
R6362:Dspp UTSW 5 104176034 missense probably benign 0.19
R6736:Dspp UTSW 5 104178175 missense unknown
R6805:Dspp UTSW 5 104175850 missense probably benign 0.03
R7064:Dspp UTSW 5 104176938 missense possibly damaging 0.73
R7178:Dspp UTSW 5 104174066 missense probably benign 0.02
R7243:Dspp UTSW 5 104178361 small deletion probably benign
R7390:Dspp UTSW 5 104175686 missense probably damaging 0.98
R7454:Dspp UTSW 5 104175610 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACAGCAGTGACAGCAGCAG -3'
(R):5'- TCACTGCTGTCAGAACTGCT -3'

Sequencing Primer
(F):5'- TGACAGCAGCAGCAGCAG -3'
(R):5'- GCTGTCAGAACTGCTATCCTTG -3'
Posted On2015-10-21