Mutagenetix > Incidental Mutation

Incidental Mutation 'R4693:Sall2'

355061

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

041944-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4693 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52314478 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 420 (H420R)

Ref Sequence

ENSEMBL: ENSMUSP00000056401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably damaging
Transcript: ENSMUST00000058326
AA Change: H420R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: H420R

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: H418R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.2031

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg8	T	C	17: 84,696,697	Y478H	probably damaging	Het
Adar	A	T	3: 89,735,940	H128L	probably damaging	Het
Angptl6	G	T	9: 20,875,302	D349E	probably damaging	Het
Anxa9	T	C	3: 95,297,356	T286A	probably benign	Het
Apobr	A	G	7: 126,586,847	N510S	probably damaging	Het
Atoh7	G	T	10: 63,100,496	R114L	probably benign	Het
Bank1	C	G	3: 136,247,676	R106P	probably damaging	Het
Best1	C	T	19: 9,997,135	G15D	probably damaging	Het
Best2	A	T	8: 85,011,203	F188I	probably damaging	Het
Ccdc88a	T	C	11: 29,482,241	Y344H	probably damaging	Het
Col6a5	A	G	9: 105,937,172	L547P	unknown	Het
Cyp19a1	A	T	9: 54,173,333	S247T	possibly damaging	Het
Cyp26a1	T	C	19: 37,698,477	S126P	probably benign	Het
Dab1	G	T	4: 104,679,553	C180F	probably damaging	Het
Dclk2	T	C	3: 86,815,093	D412G	possibly damaging	Het
Dspp	A	T	5: 104,178,062	S764C	unknown	Het
Dync1li1	C	A	9: 114,706,098	D143E	probably damaging	Het
Esm1	A	T	13: 113,210,060	D73V	probably damaging	Het
Etfdh	A	T	3: 79,605,803	V431E	probably damaging	Het
Fam83c	C	T	2: 155,830,234	R427H	probably damaging	Het
Galnt9	A	G	5: 110,615,509	Y93C	probably damaging	Het
Gm6818	G	A	7: 38,400,702		noncoding transcript	Het
Gm884	T	A	11: 103,619,860	E427D	unknown	Het
Gm8979	T	G	7: 106,082,378		noncoding transcript	Het
Gosr2	A	G	11: 103,683,929	S114P	probably benign	Het
Grip1	G	A	10: 120,000,554	V444I	probably benign	Het
Haus4	G	T	14: 54,549,799	A67E	probably benign	Het
Hectd2	T	A	19: 36,614,338		probably benign	Het
Kndc1	T	C	7: 139,921,779	Y911H	probably benign	Het
Lim2	T	C	7: 43,430,681	Y31H	probably damaging	Het
Lims2	G	A	18: 31,944,499	R101H	probably benign	Het
Lrrc2	T	A	9: 110,970,093	M236K	probably damaging	Het
Lrrk1	T	C	7: 66,262,487	Y1775C	probably damaging	Het
Mdga2	A	G	12: 66,797,633	V197A	possibly damaging	Het
Mfhas1	T	A	8: 35,589,175	L268Q	probably damaging	Het
Mlh1	A	G	9: 111,255,658	I216T	probably damaging	Het
Mrc2	G	A	11: 105,343,702	C1016Y	probably benign	Het
Mvp	C	A	7: 126,998,328	V168F	probably damaging	Het
Mybphl	A	G	3: 108,375,178	T176A	probably benign	Het
Myt1	T	A	2: 181,795,739	L81Q	probably damaging	Het
Ncbp3	T	C	11: 73,075,677	L453S	probably benign	Het
Olfr1157	A	T	2: 87,962,709	F61Y	probably benign	Het
Olfr1219	T	C	2: 89,075,068	T8A	possibly damaging	Het
Olfr1231	T	A	2: 89,303,277	E105V	probably benign	Het
Olfr1456-ps1	C	A	19: 13,078,862		noncoding transcript	Het
Olfr545	T	A	7: 102,494,452	I108F	probably damaging	Het
Pak4	A	T	7: 28,564,249	M354K	probably damaging	Het
Pax3	T	C	1: 78,196,746	T2A	probably benign	Het
Pcdh17	A	G	14: 84,533,520	D1146G	probably damaging	Het
Pcyt1a	T	C	16: 32,470,224		probably benign	Het
Pfkp	C	T	13: 6,600,635	G467D	possibly damaging	Het
Plin4	C	A	17: 56,103,762	G1090C	probably damaging	Het
Pth1r	A	G	9: 110,731,624	V25A	probably damaging	Het
Ptk2b	C	T	14: 66,157,069	G859S	probably benign	Het
Ptprf	T	A	4: 118,211,022	E1772D	probably benign	Het
Sbds	G	A	5: 130,250,975	R63W	probably damaging	Het
Sccpdh	A	G	1: 179,668,410	T19A	possibly damaging	Het
Scn8a	A	T	15: 101,015,691	D988V	probably damaging	Het
Slamf6	C	T	1: 171,934,113	Q34*	probably null	Het
Slc22a6	T	A	19: 8,623,652	I403N	probably damaging	Het
Sox5	T	C	6: 143,835,316	Y574C	probably damaging	Het
Sptbn5	T	A	2: 120,059,416		probably benign	Het
Srcap	T	A	7: 127,538,544	V1022E	probably damaging	Het
Tbx3	G	A	5: 119,677,570	E292K	possibly damaging	Het
Tbx5	A	T	5: 119,841,899	H170L	probably damaging	Het
Tcf12	A	T	9: 71,868,967		probably benign	Het
Themis	G	A	10: 28,782,651	R558H	probably damaging	Het
Tiam1	T	C	16: 89,843,282	E849G	possibly damaging	Het
Vav3	A	G	3: 109,563,218		probably benign	Het
Vmn2r90	T	A	17: 17,733,694	C707S	possibly damaging	Het
Vmn2r96	T	G	17: 18,583,008	N201K	probably benign	Het
Zfp148	C	T	16: 33,468,135	R207C	probably damaging	Het
Zfp648	G	T	1: 154,204,406	A104S	probably benign	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- CTTGTTGAAAGTAGGGAGCCC -3'
(R):5'- CAGTTCCTTGGAGAAACCCG -3'

Sequencing Primer
(F):5'- AGAGCAGTGTCAGGCTCTCTG -3'
(R):5'- AACCCGGTGGAAGGCAC -3'

Posted On

2015-10-21