Incidental Mutation 'R4693:Cyp26a1'
ID355076
Institutional Source Beutler Lab
Gene Symbol Cyp26a1
Ensembl Gene ENSMUSG00000024987
Gene Namecytochrome P450, family 26, subfamily a, polypeptide 1
SynonymsCyp26, P450RA, P450RAI, retinoic acid hydrolase, RAH
MMRRC Submission 041944-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4693 (G1)
Quality Score203
Status Validated
Chromosome19
Chromosomal Location37697808-37701528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37698477 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 126 (S126P)
Ref Sequence ENSEMBL: ENSMUSP00000025946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025946]
Predicted Effect probably benign
Transcript: ENSMUST00000025946
AA Change: S126P

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025946
Gene: ENSMUSG00000024987
AA Change: S126P

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:p450 45 487 2.4e-68 PFAM
Meta Mutation Damage Score 0.2808 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein acts on retinoids, including all-trans-retinoic acid (RA), with both 4-hydroxylation and 18-hydroxylation activities. This enzyme regulates the cellular level of retinoic acid which is involved in regulation of gene expression in both embryonic and adult tissues. Two alternatively spliced transcript variants of this gene, which encode the distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die during mid-late gestation and exhibit spina bifida, caudal agenesis, and abnormalities of the kidneys, urogenital tract, hindgut, cervical vertebrae, and rostral hindbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,696,697 Y478H probably damaging Het
Adar A T 3: 89,735,940 H128L probably damaging Het
Angptl6 G T 9: 20,875,302 D349E probably damaging Het
Anxa9 T C 3: 95,297,356 T286A probably benign Het
Apobr A G 7: 126,586,847 N510S probably damaging Het
Atoh7 G T 10: 63,100,496 R114L probably benign Het
Bank1 C G 3: 136,247,676 R106P probably damaging Het
Best1 C T 19: 9,997,135 G15D probably damaging Het
Best2 A T 8: 85,011,203 F188I probably damaging Het
Ccdc88a T C 11: 29,482,241 Y344H probably damaging Het
Col6a5 A G 9: 105,937,172 L547P unknown Het
Cyp19a1 A T 9: 54,173,333 S247T possibly damaging Het
Dab1 G T 4: 104,679,553 C180F probably damaging Het
Dclk2 T C 3: 86,815,093 D412G possibly damaging Het
Dspp A T 5: 104,178,062 S764C unknown Het
Dync1li1 C A 9: 114,706,098 D143E probably damaging Het
Esm1 A T 13: 113,210,060 D73V probably damaging Het
Etfdh A T 3: 79,605,803 V431E probably damaging Het
Fam83c C T 2: 155,830,234 R427H probably damaging Het
Galnt9 A G 5: 110,615,509 Y93C probably damaging Het
Gm6818 G A 7: 38,400,702 noncoding transcript Het
Gm884 T A 11: 103,619,860 E427D unknown Het
Gm8979 T G 7: 106,082,378 noncoding transcript Het
Gosr2 A G 11: 103,683,929 S114P probably benign Het
Grip1 G A 10: 120,000,554 V444I probably benign Het
Haus4 G T 14: 54,549,799 A67E probably benign Het
Hectd2 T A 19: 36,614,338 probably benign Het
Kndc1 T C 7: 139,921,779 Y911H probably benign Het
Lim2 T C 7: 43,430,681 Y31H probably damaging Het
Lims2 G A 18: 31,944,499 R101H probably benign Het
Lrrc2 T A 9: 110,970,093 M236K probably damaging Het
Lrrk1 T C 7: 66,262,487 Y1775C probably damaging Het
Mdga2 A G 12: 66,797,633 V197A possibly damaging Het
Mfhas1 T A 8: 35,589,175 L268Q probably damaging Het
Mlh1 A G 9: 111,255,658 I216T probably damaging Het
Mrc2 G A 11: 105,343,702 C1016Y probably benign Het
Mvp C A 7: 126,998,328 V168F probably damaging Het
Mybphl A G 3: 108,375,178 T176A probably benign Het
Myt1 T A 2: 181,795,739 L81Q probably damaging Het
Ncbp3 T C 11: 73,075,677 L453S probably benign Het
Olfr1157 A T 2: 87,962,709 F61Y probably benign Het
Olfr1219 T C 2: 89,075,068 T8A possibly damaging Het
Olfr1231 T A 2: 89,303,277 E105V probably benign Het
Olfr1456-ps1 C A 19: 13,078,862 noncoding transcript Het
Olfr545 T A 7: 102,494,452 I108F probably damaging Het
Pak4 A T 7: 28,564,249 M354K probably damaging Het
Pax3 T C 1: 78,196,746 T2A probably benign Het
Pcdh17 A G 14: 84,533,520 D1146G probably damaging Het
Pcyt1a T C 16: 32,470,224 probably benign Het
Pfkp C T 13: 6,600,635 G467D possibly damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Pth1r A G 9: 110,731,624 V25A probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Ptprf T A 4: 118,211,022 E1772D probably benign Het
Sall2 T C 14: 52,314,478 H420R probably damaging Het
Sbds G A 5: 130,250,975 R63W probably damaging Het
Sccpdh A G 1: 179,668,410 T19A possibly damaging Het
Scn8a A T 15: 101,015,691 D988V probably damaging Het
Slamf6 C T 1: 171,934,113 Q34* probably null Het
Slc22a6 T A 19: 8,623,652 I403N probably damaging Het
Sox5 T C 6: 143,835,316 Y574C probably damaging Het
Sptbn5 T A 2: 120,059,416 probably benign Het
Srcap T A 7: 127,538,544 V1022E probably damaging Het
Tbx3 G A 5: 119,677,570 E292K possibly damaging Het
Tbx5 A T 5: 119,841,899 H170L probably damaging Het
Tcf12 A T 9: 71,868,967 probably benign Het
Themis G A 10: 28,782,651 R558H probably damaging Het
Tiam1 T C 16: 89,843,282 E849G possibly damaging Het
Vav3 A G 3: 109,563,218 probably benign Het
Vmn2r90 T A 17: 17,733,694 C707S possibly damaging Het
Vmn2r96 T G 17: 18,583,008 N201K probably benign Het
Zfp148 C T 16: 33,468,135 R207C probably damaging Het
Zfp648 G T 1: 154,204,406 A104S probably benign Het
Other mutations in Cyp26a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Cyp26a1 APN 19 37700002 missense probably benign 0.00
IGL01398:Cyp26a1 APN 19 37697947 missense probably damaging 1.00
IGL01624:Cyp26a1 APN 19 37698333 missense possibly damaging 0.94
IGL02398:Cyp26a1 APN 19 37700019 missense probably benign
IGL02437:Cyp26a1 APN 19 37698495 missense probably benign
IGL02709:Cyp26a1 APN 19 37699978 missense probably damaging 1.00
IGL02712:Cyp26a1 APN 19 37699978 missense probably damaging 1.00
R0834:Cyp26a1 UTSW 19 37699957 missense probably damaging 0.96
R1517:Cyp26a1 UTSW 19 37698860 missense probably benign
R1696:Cyp26a1 UTSW 19 37701178 missense probably benign 0.02
R1831:Cyp26a1 UTSW 19 37700623 missense probably damaging 0.98
R2040:Cyp26a1 UTSW 19 37698051 missense possibly damaging 0.46
R2504:Cyp26a1 UTSW 19 37698342 missense probably damaging 1.00
R4808:Cyp26a1 UTSW 19 37701125 missense probably benign
R5124:Cyp26a1 UTSW 19 37701217 missense probably benign 0.01
R5412:Cyp26a1 UTSW 19 37701182 missense probably damaging 1.00
R5964:Cyp26a1 UTSW 19 37699962 missense probably damaging 1.00
R6355:Cyp26a1 UTSW 19 37698929 missense possibly damaging 0.46
R6426:Cyp26a1 UTSW 19 37699305 missense probably benign 0.14
R6501:Cyp26a1 UTSW 19 37699070 missense possibly damaging 0.80
R6734:Cyp26a1 UTSW 19 37701212 missense probably damaging 1.00
R7019:Cyp26a1 UTSW 19 37698812 missense probably damaging 1.00
R7188:Cyp26a1 UTSW 19 37699305 missense possibly damaging 0.64
R7667:Cyp26a1 UTSW 19 37700624 missense possibly damaging 0.83
R7694:Cyp26a1 UTSW 19 37701064 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTTCTGCAGATGAAGCGCAG -3'
(R):5'- GAGTACCCTTTCAAGAATTTCAGTCC -3'

Sequencing Primer
(F):5'- GCGCAGGAAATACGGCTTCATC -3'
(R):5'- GGACTAACCCACGTGCTAG -3'
Posted On2015-10-21