Incidental Mutation 'R4705:Odf2'
ID355085
Institutional Source Beutler Lab
Gene Symbol Odf2
Ensembl Gene ENSMUSG00000026790
Gene Nameouter dense fiber of sperm tails 2
SynonymsMMTEST29, cenexin
MMRRC Submission 041953-MU
Accession Numbers

Genbank: NM_001113213; MGI: 1098824 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4705 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29889221-29931746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29904034 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 301 (L301Q)
Ref Sequence ENSEMBL: ENSMUSP00000109396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028128] [ENSMUST00000046571] [ENSMUST00000113755] [ENSMUST00000113756] [ENSMUST00000113757] [ENSMUST00000113759] [ENSMUST00000113762] [ENSMUST00000113763] [ENSMUST00000113764] [ENSMUST00000113765] [ENSMUST00000184845] [ENSMUST00000113767] [ENSMUST00000133233] [ENSMUST00000123335]
Predicted Effect probably damaging
Transcript: ENSMUST00000028128
AA Change: L238Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028128
Gene: ENSMUSG00000026790
AA Change: L238Q

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000046571
AA Change: L252Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049272
Gene: ENSMUSG00000026790
AA Change: L252Q

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113755
AA Change: L252Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109384
Gene: ENSMUSG00000026790
AA Change: L252Q

DomainStartEndE-ValueType
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_1 262 298 2.12e-5 PROSPERO
internal_repeat_1 461 495 2.12e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113756
AA Change: L252Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109385
Gene: ENSMUSG00000026790
AA Change: L252Q

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113757
AA Change: L233Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109386
Gene: ENSMUSG00000026790
AA Change: L233Q

DomainStartEndE-ValueType
internal_repeat_2 101 119 9.13e-6 PROSPERO
coiled coil region 120 192 N/A INTRINSIC
internal_repeat_2 199 217 9.13e-6 PROSPERO
internal_repeat_1 243 279 3.83e-7 PROSPERO
internal_repeat_1 442 476 3.83e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113759
AA Change: L252Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109388
Gene: ENSMUSG00000026790
AA Change: L252Q

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.82e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.82e-5 PROSPERO
internal_repeat_1 262 299 1.55e-6 PROSPERO
internal_repeat_1 462 496 1.55e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113762
AA Change: L257Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109391
Gene: ENSMUSG00000026790
AA Change: L257Q

DomainStartEndE-ValueType
coiled coil region 144 216 N/A INTRINSIC
internal_repeat_1 267 303 1.9e-5 PROSPERO
internal_repeat_1 466 500 1.9e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113763
AA Change: L238Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109392
Gene: ENSMUSG00000026790
AA Change: L238Q

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113764
AA Change: L238Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109393
Gene: ENSMUSG00000026790
AA Change: L238Q

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113765
AA Change: L257Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109394
Gene: ENSMUSG00000026790
AA Change: L257Q

DomainStartEndE-ValueType
internal_repeat_2 125 143 1.66e-5 PROSPERO
coiled coil region 144 216 N/A INTRINSIC
internal_repeat_2 223 241 1.66e-5 PROSPERO
internal_repeat_1 267 303 7.56e-7 PROSPERO
internal_repeat_1 466 500 7.56e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152932
Predicted Effect probably damaging
Transcript: ENSMUST00000184845
AA Change: L252Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139390
Gene: ENSMUSG00000026790
AA Change: L252Q

DomainStartEndE-ValueType
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_1 262 298 3.95e-5 PROSPERO
internal_repeat_1 461 495 3.95e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000137558
AA Change: L256Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117887
Gene: ENSMUSG00000026790
AA Change: L256Q

DomainStartEndE-ValueType
coiled coil region 143 215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113767
AA Change: L301Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109396
Gene: ENSMUSG00000026790
AA Change: L301Q

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
coiled coil region 188 260 N/A INTRINSIC
internal_repeat_1 311 347 3e-5 PROSPERO
internal_repeat_1 510 544 3e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130899
Predicted Effect probably benign
Transcript: ENSMUST00000133233
Predicted Effect probably benign
Transcript: ENSMUST00000123335
Meta Mutation Damage Score 0.3547 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 96% (113/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The outer dense fibers are cytoskeletal structures that surround the axoneme in the middle piece and principal piece of the sperm tail. The fibers function in maintaining the elastic structure and recoil of the sperm tail as well as in protecting the tail from shear forces during epididymal transport and ejaculation. Defects in the outer dense fibers lead to abnormal sperm morphology and infertility. This gene encodes one of the major outer dense fiber proteins. Alternative splicing results in multiple transcript variants. The longer transcripts, also known as 'Cenexins', encode proteins with a C-terminal extension that are differentially targeted to somatic centrioles and thought to be crucial for the formation of microtubule organizing centers. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality before implantation and transmission ratio distortion while all heterozygous males display normal development and fertility. Males heterozygous for other alleles are either infertile orshow reduced fertility. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,635 N325D possibly damaging Het
1700056E22Rik A G 1: 184,033,172 V230A possibly damaging Het
2010315B03Rik T C 9: 124,294,001 T123A possibly damaging Het
4932438A13Rik C T 3: 37,041,889 T1108I probably benign Het
Abca4 T C 3: 122,105,370 V667A probably damaging Het
Abcb5 A G 12: 118,965,305 S4P possibly damaging Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Ahnak C A 19: 9,016,906 H5185N probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
Atf7ip C T 6: 136,561,194 P483L probably damaging Het
Atp11a C G 8: 12,813,118 P99R probably damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bag6 C A 17: 35,142,343 P476H probably damaging Het
BC049730 T A 7: 24,713,509 L114Q probably damaging Het
C2cd3 A G 7: 100,395,188 K326E possibly damaging Het
Casp1 A G 9: 5,306,204 D363G probably damaging Het
Ccdc33 G T 9: 58,117,557 Q129K probably benign Het
Ccdc88a T C 11: 29,422,586 I107T probably benign Het
Cela2a T C 4: 141,821,411 N138S probably benign Het
Cfap61 A C 2: 146,035,202 R460S probably damaging Het
Clstn2 T C 9: 97,463,559 N579D possibly damaging Het
Col13a1 C A 10: 61,850,165 G683W unknown Het
Col4a2 G A 8: 11,313,504 R14Q possibly damaging Het
Cpa6 A G 1: 10,481,058 S164P probably benign Het
Cpq A G 15: 33,497,338 N408S probably benign Het
Ctnnal1 T C 4: 56,812,579 T690A probably benign Het
Cx3cl1 A T 8: 94,780,207 N280I probably benign Het
Cyp2b19 C T 7: 26,757,292 R36C probably benign Het
Ddx51 T C 5: 110,655,308 V269A probably damaging Het
Dlst G T 12: 85,118,842 probably null Het
Dmkn G C 7: 30,763,981 A20P probably damaging Het
Dnhd1 T C 7: 105,655,741 I330T probably damaging Het
Dock3 G A 9: 107,025,336 H292Y probably damaging Het
Ell A G 8: 70,578,934 D94G possibly damaging Het
Enam T A 5: 88,503,791 L1053* probably null Het
Fcgbp A G 7: 28,107,296 K2230E probably benign Het
Frmd5 G T 2: 121,562,863 probably benign Het
Gas2l1 G A 11: 5,060,867 S654L possibly damaging Het
Gltpd2 G T 11: 70,520,140 E86* probably null Het
Glyat T C 19: 12,651,297 L152P possibly damaging Het
Gm17330 T C 12: 23,968,782 T22A probably damaging Het
Gm9931 T A 1: 147,281,853 noncoding transcript Het
Gpatch1 A T 7: 35,299,305 probably null Het
Gpr4 T C 7: 19,222,894 L247P probably damaging Het
Gtpbp3 G A 8: 71,491,114 E214K probably benign Het
Hdac7 G T 15: 97,811,587 Q21K probably damaging Het
Hivep3 A G 4: 119,872,050 probably benign Het
Hk2 C T 6: 82,739,650 M300I possibly damaging Het
Ighv1-61 T C 12: 115,359,279 Y71C probably damaging Het
Il1f8 T C 2: 24,154,618 V10A probably benign Het
Inpp5f G T 7: 128,663,987 S152I probably damaging Het
Jag1 C A 2: 137,096,309 W257L probably damaging Het
Jak2 T A 19: 29,294,915 N612K possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kbtbd6 A G 14: 79,452,606 D247G probably benign Het
Kif15 A G 9: 122,959,993 probably null Het
Kndc1 A G 7: 139,930,123 T1293A possibly damaging Het
Lpar5 T C 6: 125,082,207 I297T possibly damaging Het
Lpin2 T A 17: 71,232,143 probably benign Het
Mfsd4a A T 1: 132,053,571 L230Q probably damaging Het
Mmp8 T C 9: 7,565,549 V313A probably benign Het
Mrpl19 A T 6: 81,964,285 D98E probably damaging Het
Mybl1 A G 1: 9,690,115 I86T probably damaging Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Necab1 T C 4: 15,052,628 T117A probably damaging Het
Nol11 A G 11: 107,184,718 probably benign Het
Nucb2 G A 7: 116,540,027 probably null Het
Nupl1 G T 14: 60,251,215 P19T unknown Het
Oit1 T C 14: 8,349,347 E201G probably benign Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr736 A G 14: 50,392,800 I15V probably benign Het
Oog4 T C 4: 143,438,875 Y234C probably benign Het
Papln T C 12: 83,777,208 probably null Het
Paqr6 C T 3: 88,365,929 A76V probably benign Het
Pclo A G 5: 14,676,480 probably benign Het
Pdzd8 T C 19: 59,345,311 T93A possibly damaging Het
Pkdrej A T 15: 85,821,167 Y189* probably null Het
Pknox2 A T 9: 36,923,638 N178K possibly damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plxnd1 A C 6: 115,958,620 L1735R probably damaging Het
Polm T A 11: 5,837,663 D30V possibly damaging Het
Rap1gap2 T A 11: 74,437,439 I100F probably damaging Het
Rasgef1c T A 11: 49,978,467 W414R probably benign Het
Rassf1 A G 9: 107,557,867 D187G probably benign Het
Rhag T C 17: 40,836,438 I397T probably benign Het
Rnft2 A G 5: 118,228,863 F269S probably damaging Het
Rnmt T C 18: 68,314,125 F360S probably damaging Het
Ror2 C T 13: 53,117,297 A329T probably benign Het
Slc4a1 T A 11: 102,356,258 N501I possibly damaging Het
Slc4a7 T A 14: 14,733,856 S89T probably damaging Het
Sptbn1 G A 11: 30,100,660 H2310Y probably benign Het
Tbc1d9b C A 11: 50,140,462 N103K probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tmem100 C T 11: 90,035,563 T72I probably damaging Het
Ttc38 A G 15: 85,852,963 T350A probably benign Het
Ubr4 C T 4: 139,450,529 T3241M probably damaging Het
Unc13d A T 11: 116,073,388 M350K possibly damaging Het
Vit T C 17: 78,625,114 I550T probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Zbtb12 T A 17: 34,896,401 H387Q possibly damaging Het
Other mutations in Odf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Odf2 APN 2 29893059 missense probably damaging 1.00
IGL01511:Odf2 APN 2 29914309 splice site probably benign
IGL01760:Odf2 APN 2 29914460 missense probably damaging 1.00
IGL02487:Odf2 APN 2 29920839 missense possibly damaging 0.80
IGL03047:Odf2 APN 2 29920895 splice site probably benign
IGL03057:Odf2 APN 2 29923645 intron probably benign
IGL03064:Odf2 APN 2 29901079 missense probably benign 0.28
3-1:Odf2 UTSW 2 29904075 nonsense probably null
IGL02837:Odf2 UTSW 2 29926713 missense probably damaging 0.99
R4025:Odf2 UTSW 2 29926815 missense probably damaging 1.00
R4227:Odf2 UTSW 2 29901284 intron probably benign
R4357:Odf2 UTSW 2 29892244 missense probably benign 0.00
R4417:Odf2 UTSW 2 29915321 splice site probably benign
R4512:Odf2 UTSW 2 29926097 splice site probably null
R4815:Odf2 UTSW 2 29902240 missense possibly damaging 0.87
R5325:Odf2 UTSW 2 29912571 missense probably benign 0.19
R5614:Odf2 UTSW 2 29920867 missense probably damaging 0.99
R6998:Odf2 UTSW 2 29912617 missense probably benign 0.43
R7740:Odf2 UTSW 2 29930624 missense probably damaging 1.00
R7963:Odf2 UTSW 2 29926100 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TCACACGCATTTCAGGACCC -3'
(R):5'- TGCCTTCTGAGACTGCTCTG -3'

Sequencing Primer
(F):5'- CAGTGCCTCTAGTCTTGGC -3'
(R):5'- GAGACTGCTCTGTTCCTTCTG -3'
Posted On2015-10-21