Mutagenetix > Incidental Mutation

Incidental Mutation 'R4705:4932438A13Rik'

355092

Institutional Source

Beutler Lab

Gene Symbol

4932438A13Rik

Ensembl Gene

ENSMUSG00000037270

Gene Name

RIKEN cDNA 4932438A13 gene

Synonyms

Tweek, FSA

MMRRC Submission

041953-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4705 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36863104-37053033 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 37041889 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1108 (T1108I)

Ref Sequence

ENSEMBL: ENSMUSP00000118092 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000138950] [ENSMUST00000152564]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000057272
AA Change: T4606I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270
AA Change: T4606I

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
low complexity region	701	716	N/A	INTRINSIC
low complexity region	767	779	N/A	INTRINSIC
low complexity region	1127	1138	N/A	INTRINSIC
low complexity region	1154	1166	N/A	INTRINSIC
low complexity region	1226	1240	N/A	INTRINSIC
low complexity region	1381	1402	N/A	INTRINSIC
low complexity region	1541	1547	N/A	INTRINSIC
low complexity region	1593	1607	N/A	INTRINSIC
low complexity region	1810	1821	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2182	2191	N/A	INTRINSIC
low complexity region	2336	2349	N/A	INTRINSIC
low complexity region	2614	2657	N/A	INTRINSIC
low complexity region	3468	3480	N/A	INTRINSIC
low complexity region	3717	3742	N/A	INTRINSIC
low complexity region	3816	3837	N/A	INTRINSIC
low complexity region	3919	3929	N/A	INTRINSIC
low complexity region	3941	3948	N/A	INTRINSIC
low complexity region	4024	4038	N/A	INTRINSIC
low complexity region	4041	4049	N/A	INTRINSIC
low complexity region	4117	4149	N/A	INTRINSIC
low complexity region	4172	4185	N/A	INTRINSIC
low complexity region	4359	4380	N/A	INTRINSIC
FSA_C	4386	4990	N/A	SMART
low complexity region	4993	5004	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136746

Predicted Effect

probably benign
Transcript: ENSMUST00000138950
AA Change: T1108I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000118092
Gene: ENSMUSG00000037270
AA Change: T1108I

Domain	Start	End	E-Value	Type
low complexity region	254	279	N/A	INTRINSIC
low complexity region	353	374	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	543	551	N/A	INTRINSIC
low complexity region	619	651	N/A	INTRINSIC
low complexity region	674	687	N/A	INTRINSIC
low complexity region	861	882	N/A	INTRINSIC
FSA_C	888	1492	N/A	SMART
low complexity region	1495	1506	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000141740
AA Change: T1186I

SMART Domains

Protein: ENSMUSP00000117814
Gene: ENSMUSG00000037270
AA Change: T1186I

Domain	Start	End	E-Value	Type
low complexity region	28	40	N/A	INTRINSIC
low complexity region	298	323	N/A	INTRINSIC
low complexity region	397	418	N/A	INTRINSIC
low complexity region	500	510	N/A	INTRINSIC
low complexity region	522	529	N/A	INTRINSIC
low complexity region	605	619	N/A	INTRINSIC
low complexity region	622	630	N/A	INTRINSIC
low complexity region	698	730	N/A	INTRINSIC
low complexity region	753	766	N/A	INTRINSIC
low complexity region	940	961	N/A	INTRINSIC
FSA_C	967	1571	N/A	SMART
low complexity region	1574	1585	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000146948
AA Change: T1311I

SMART Domains

Protein: ENSMUSP00000121356
Gene: ENSMUSG00000037270
AA Change: T1311I

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	167	177	N/A	INTRINSIC
low complexity region	458	483	N/A	INTRINSIC
low complexity region	557	578	N/A	INTRINSIC
low complexity region	730	744	N/A	INTRINSIC
low complexity region	747	755	N/A	INTRINSIC
low complexity region	823	855	N/A	INTRINSIC
low complexity region	878	891	N/A	INTRINSIC
low complexity region	1065	1086	N/A	INTRINSIC
FSA_C	1092	1696	N/A	SMART
low complexity region	1699	1710	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148698

Predicted Effect

probably benign
Transcript: ENSMUST00000152564
AA Change: T4606I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270
AA Change: T4606I

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
low complexity region	701	716	N/A	INTRINSIC
low complexity region	767	779	N/A	INTRINSIC
low complexity region	1127	1138	N/A	INTRINSIC
low complexity region	1154	1166	N/A	INTRINSIC
low complexity region	1226	1240	N/A	INTRINSIC
low complexity region	1381	1402	N/A	INTRINSIC
low complexity region	1541	1547	N/A	INTRINSIC
low complexity region	1593	1607	N/A	INTRINSIC
low complexity region	1810	1821	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2182	2191	N/A	INTRINSIC
low complexity region	2336	2349	N/A	INTRINSIC
low complexity region	2614	2657	N/A	INTRINSIC
low complexity region	3468	3480	N/A	INTRINSIC
low complexity region	3717	3742	N/A	INTRINSIC
low complexity region	3816	3837	N/A	INTRINSIC
low complexity region	3919	3929	N/A	INTRINSIC
low complexity region	3941	3948	N/A	INTRINSIC
low complexity region	4024	4038	N/A	INTRINSIC
low complexity region	4041	4049	N/A	INTRINSIC
low complexity region	4117	4149	N/A	INTRINSIC
low complexity region	4172	4185	N/A	INTRINSIC
low complexity region	4359	4380	N/A	INTRINSIC
FSA_C	4386	4990	N/A	SMART
low complexity region	4993	5004	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196036

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200245

Meta Mutation Damage Score

0.0909

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

96% (113/118)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	T	C	9: 94,520,635	N325D	possibly damaging	Het
1700056E22Rik	A	G	1: 184,033,172	V230A	possibly damaging	Het
2010315B03Rik	T	C	9: 124,294,001	T123A	possibly damaging	Het
Abca4	T	C	3: 122,105,370	V667A	probably damaging	Het
Abcb5	A	G	12: 118,965,305	S4P	possibly damaging	Het
Adam25	G	T	8: 40,754,126	C143F	probably damaging	Het
Ahnak	C	A	19: 9,016,906	H5185N	probably benign	Het
Apobec4	A	G	1: 152,756,250	T10A	probably benign	Het
Ascc1	A	G	10: 60,049,802	Y225C	probably damaging	Het
Aspscr1	A	T	11: 120,688,945	K39N	possibly damaging	Het
Atf7ip	C	T	6: 136,561,194	P483L	probably damaging	Het
Atp11a	C	G	8: 12,813,118	P99R	probably damaging	Het
B4galnt1	G	T	10: 127,167,525	V172F	possibly damaging	Het
Bag6	C	A	17: 35,142,343	P476H	probably damaging	Het
BC049730	T	A	7: 24,713,509	L114Q	probably damaging	Het
C2cd3	A	G	7: 100,395,188	K326E	possibly damaging	Het
Casp1	A	G	9: 5,306,204	D363G	probably damaging	Het
Ccdc33	G	T	9: 58,117,557	Q129K	probably benign	Het
Ccdc88a	T	C	11: 29,422,586	I107T	probably benign	Het
Cela2a	T	C	4: 141,821,411	N138S	probably benign	Het
Cfap61	A	C	2: 146,035,202	R460S	probably damaging	Het
Clstn2	T	C	9: 97,463,559	N579D	possibly damaging	Het
Col13a1	C	A	10: 61,850,165	G683W	unknown	Het
Col4a2	G	A	8: 11,313,504	R14Q	possibly damaging	Het
Cpa6	A	G	1: 10,481,058	S164P	probably benign	Het
Cpq	A	G	15: 33,497,338	N408S	probably benign	Het
Ctnnal1	T	C	4: 56,812,579	T690A	probably benign	Het
Cx3cl1	A	T	8: 94,780,207	N280I	probably benign	Het
Cyp2b19	C	T	7: 26,757,292	R36C	probably benign	Het
Ddx51	T	C	5: 110,655,308	V269A	probably damaging	Het
Dlst	G	T	12: 85,118,842		probably null	Het
Dmkn	G	C	7: 30,763,981	A20P	probably damaging	Het
Dnhd1	T	C	7: 105,655,741	I330T	probably damaging	Het
Dock3	G	A	9: 107,025,336	H292Y	probably damaging	Het
Ell	A	G	8: 70,578,934	D94G	possibly damaging	Het
Enam	T	A	5: 88,503,791	L1053*	probably null	Het
Fcgbp	A	G	7: 28,107,296	K2230E	probably benign	Het
Frmd5	G	T	2: 121,562,863		probably benign	Het
Gas2l1	G	A	11: 5,060,867	S654L	possibly damaging	Het
Gltpd2	G	T	11: 70,520,140	E86*	probably null	Het
Glyat	T	C	19: 12,651,297	L152P	possibly damaging	Het
Gm17330	T	C	12: 23,968,782	T22A	probably damaging	Het
Gm9931	T	A	1: 147,281,853		noncoding transcript	Het
Gpatch1	A	T	7: 35,299,305		probably null	Het
Gpr4	T	C	7: 19,222,894	L247P	probably damaging	Het
Gtpbp3	G	A	8: 71,491,114	E214K	probably benign	Het
Hdac7	G	T	15: 97,811,587	Q21K	probably damaging	Het
Hivep3	A	G	4: 119,872,050		probably benign	Het
Hk2	C	T	6: 82,739,650	M300I	possibly damaging	Het
Ighv1-61	T	C	12: 115,359,279	Y71C	probably damaging	Het
Il1f8	T	C	2: 24,154,618	V10A	probably benign	Het
Inpp5f	G	T	7: 128,663,987	S152I	probably damaging	Het
Jag1	C	A	2: 137,096,309	W257L	probably damaging	Het
Jak2	T	A	19: 29,294,915	N612K	possibly damaging	Het
Kalrn	T	C	16: 34,203,957	D610G	probably damaging	Het
Kbtbd6	A	G	14: 79,452,606	D247G	probably benign	Het
Kif15	A	G	9: 122,959,993		probably null	Het
Kndc1	A	G	7: 139,930,123	T1293A	possibly damaging	Het
Lpar5	T	C	6: 125,082,207	I297T	possibly damaging	Het
Lpin2	T	A	17: 71,232,143		probably benign	Het
Mfsd4a	A	T	1: 132,053,571	L230Q	probably damaging	Het
Mmp8	T	C	9: 7,565,549	V313A	probably benign	Het
Mrpl19	A	T	6: 81,964,285	D98E	probably damaging	Het
Mybl1	A	G	1: 9,690,115	I86T	probably damaging	Het
Nadk	C	A	4: 155,585,227	P157T	probably benign	Het
Necab1	T	C	4: 15,052,628	T117A	probably damaging	Het
Nol11	A	G	11: 107,184,718		probably benign	Het
Nucb2	G	A	7: 116,540,027		probably null	Het
Nupl1	G	T	14: 60,251,215	P19T	unknown	Het
Odf2	T	A	2: 29,904,034	L301Q	probably damaging	Het
Oit1	T	C	14: 8,349,347	E201G	probably benign	Het
Olfr374	T	A	8: 72,110,200	F211L	probably damaging	Het
Olfr736	A	G	14: 50,392,800	I15V	probably benign	Het
Oog4	T	C	4: 143,438,875	Y234C	probably benign	Het
Papln	T	C	12: 83,777,208		probably null	Het
Paqr6	C	T	3: 88,365,929	A76V	probably benign	Het
Pclo	A	G	5: 14,676,480		probably benign	Het
Pdzd8	T	C	19: 59,345,311	T93A	possibly damaging	Het
Pkdrej	A	T	15: 85,821,167	Y189*	probably null	Het
Pknox2	A	T	9: 36,923,638	N178K	possibly damaging	Het
Pla2g15	T	A	8: 106,163,059	M321K	probably benign	Het
Plxnd1	A	C	6: 115,958,620	L1735R	probably damaging	Het
Polm	T	A	11: 5,837,663	D30V	possibly damaging	Het
Rap1gap2	T	A	11: 74,437,439	I100F	probably damaging	Het
Rasgef1c	T	A	11: 49,978,467	W414R	probably benign	Het
Rassf1	A	G	9: 107,557,867	D187G	probably benign	Het
Rhag	T	C	17: 40,836,438	I397T	probably benign	Het
Rnft2	A	G	5: 118,228,863	F269S	probably damaging	Het
Rnmt	T	C	18: 68,314,125	F360S	probably damaging	Het
Ror2	C	T	13: 53,117,297	A329T	probably benign	Het
Slc4a1	T	A	11: 102,356,258	N501I	possibly damaging	Het
Slc4a7	T	A	14: 14,733,856	S89T	probably damaging	Het
Sptbn1	G	A	11: 30,100,660	H2310Y	probably benign	Het
Tbc1d9b	C	A	11: 50,140,462	N103K	probably benign	Het
Tbxas1	T	C	6: 39,083,857		probably null	Het
Tmem100	C	T	11: 90,035,563	T72I	probably damaging	Het
Ttc38	A	G	15: 85,852,963	T350A	probably benign	Het
Ubr4	C	T	4: 139,450,529	T3241M	probably damaging	Het
Unc13d	A	T	11: 116,073,388	M350K	possibly damaging	Het
Vit	T	C	17: 78,625,114	I550T	probably damaging	Het
Vmn1r31	C	A	6: 58,471,968	*304L	probably null	Het
Zbtb12	T	A	17: 34,896,401	H387Q	possibly damaging	Het

Other mutations in 4932438A13Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:4932438A13Rik	APN	3	37011727	missense	probably benign	0.00
IGL00434:4932438A13Rik	APN	3	36987299	missense	probably damaging	0.98
IGL00640:4932438A13Rik	APN	3	36908218	missense	probably damaging	1.00
IGL00693:4932438A13Rik	APN	3	37052547	utr 3 prime	probably benign
IGL00721:4932438A13Rik	APN	3	37030751	splice site	probably null
IGL00756:4932438A13Rik	APN	3	36908218	missense	probably damaging	1.00
IGL00896:4932438A13Rik	APN	3	37039462	missense	probably benign
IGL00902:4932438A13Rik	APN	3	37041345	missense	probably damaging	1.00
IGL00980:4932438A13Rik	APN	3	37000041	missense	probably damaging	1.00
IGL01019:4932438A13Rik	APN	3	37006984	critical splice acceptor site	probably null
IGL01025:4932438A13Rik	APN	3	37046280	missense	possibly damaging	0.89
IGL01306:4932438A13Rik	APN	3	37005013	splice site	probably benign
IGL01370:4932438A13Rik	APN	3	36947755	missense	probably benign	0.07
IGL01377:4932438A13Rik	APN	3	36973452	critical splice donor site	probably null
IGL01401:4932438A13Rik	APN	3	36942292	missense	probably benign
IGL01419:4932438A13Rik	APN	3	37048121	missense	probably damaging	1.00
IGL01432:4932438A13Rik	APN	3	37003759	missense	possibly damaging	0.87
IGL01433:4932438A13Rik	APN	3	36887770	missense	probably damaging	1.00
IGL01452:4932438A13Rik	APN	3	36996308	unclassified	probably benign
IGL01520:4932438A13Rik	APN	3	36973260	nonsense	probably null
IGL01524:4932438A13Rik	APN	3	36942382	missense	possibly damaging	0.90
IGL01628:4932438A13Rik	APN	3	37008485	missense	probably damaging	1.00
IGL01638:4932438A13Rik	APN	3	36974311	missense	probably damaging	1.00
IGL01650:4932438A13Rik	APN	3	36992673	splice site	probably benign
IGL01717:4932438A13Rik	APN	3	37034736	missense	probably benign
IGL01767:4932438A13Rik	APN	3	37041363	missense	probably benign	0.29
IGL01813:4932438A13Rik	APN	3	36928520	missense	possibly damaging	0.90
IGL01998:4932438A13Rik	APN	3	36957016	missense	possibly damaging	0.49
IGL02172:4932438A13Rik	APN	3	37004873	missense	probably damaging	0.99
IGL02197:4932438A13Rik	APN	3	36906735	missense	probably damaging	1.00
IGL02248:4932438A13Rik	APN	3	36969290	critical splice donor site	probably null
IGL02273:4932438A13Rik	APN	3	36921437	splice site	probably benign
IGL02403:4932438A13Rik	APN	3	37030664	missense	probably benign
IGL02492:4932438A13Rik	APN	3	37048113	missense	probably benign	0.04
IGL02517:4932438A13Rik	APN	3	36958868	missense	probably damaging	1.00
IGL02519:4932438A13Rik	APN	3	36895315	missense	probably damaging	1.00
IGL02586:4932438A13Rik	APN	3	37044608	nonsense	probably null
IGL02620:4932438A13Rik	APN	3	37035945	missense	possibly damaging	0.95
IGL02621:4932438A13Rik	APN	3	37041484	splice site	probably benign
IGL02670:4932438A13Rik	APN	3	36967305	nonsense	probably null
IGL02806:4932438A13Rik	APN	3	36946494	missense	possibly damaging	0.95
IGL02985:4932438A13Rik	APN	3	36958757	missense	probably damaging	0.99
IGL03004:4932438A13Rik	APN	3	36965677	splice site	probably benign
IGL03037:4932438A13Rik	APN	3	36969207	missense	probably benign	0.23
IGL03037:4932438A13Rik	APN	3	36969208	missense	probably damaging	1.00
IGL03062:4932438A13Rik	APN	3	37038517	splice site	probably benign
IGL03137:4932438A13Rik	APN	3	37034602	missense	probably damaging	0.98
IGL03150:4932438A13Rik	APN	3	36948066	missense	probably damaging	1.00
IGL03204:4932438A13Rik	APN	3	37050934	splice site	probably benign
IGL03207:4932438A13Rik	APN	3	36949996	missense	possibly damaging	0.73
IGL03256:4932438A13Rik	APN	3	36906683	splice site	probably benign
IGL03264:4932438A13Rik	APN	3	37002635	missense	probably damaging	1.00
IGL03265:4932438A13Rik	APN	3	37047991	missense	probably benign	0.00
IGL03303:4932438A13Rik	APN	3	36870077	missense	possibly damaging	0.90
admonished	UTSW	3	36948304	missense	probably damaging	1.00
alerted	UTSW	3	37033265	missense	possibly damaging	0.85
informed	UTSW	3	36965849	missense	probably damaging	1.00
resolved	UTSW	3	36921221	missense	possibly damaging	0.60
tipped	UTSW	3	36988085	missense	possibly damaging	0.81
warned	UTSW	3	36965621	missense	probably damaging	1.00
FR4340:4932438A13Rik	UTSW	3	37050752	critical splice acceptor site	probably benign
FR4737:4932438A13Rik	UTSW	3	37050754	critical splice acceptor site	probably benign
PIT4515001:4932438A13Rik	UTSW	3	36974236	missense	probably damaging	1.00
R0035:4932438A13Rik	UTSW	3	36987598	nonsense	probably null
R0047:4932438A13Rik	UTSW	3	36908192	missense	possibly damaging	0.83
R0047:4932438A13Rik	UTSW	3	36908192	missense	possibly damaging	0.83
R0068:4932438A13Rik	UTSW	3	36952221	missense	probably benign	0.28
R0068:4932438A13Rik	UTSW	3	36952221	missense	probably benign	0.28
R0092:4932438A13Rik	UTSW	3	37028159	missense	probably benign	0.41
R0233:4932438A13Rik	UTSW	3	36948563	nonsense	probably null
R0233:4932438A13Rik	UTSW	3	36948563	nonsense	probably null
R0256:4932438A13Rik	UTSW	3	36917773	missense	probably benign	0.01
R0277:4932438A13Rik	UTSW	3	36943182	nonsense	probably null
R0321:4932438A13Rik	UTSW	3	36906788	splice site	probably null
R0323:4932438A13Rik	UTSW	3	36943182	nonsense	probably null
R0335:4932438A13Rik	UTSW	3	36969152	missense	probably damaging	1.00
R0375:4932438A13Rik	UTSW	3	37046252	missense	probably damaging	0.99
R0437:4932438A13Rik	UTSW	3	36989804	missense	possibly damaging	0.81
R0445:4932438A13Rik	UTSW	3	37000065	missense	probably damaging	0.99
R0496:4932438A13Rik	UTSW	3	36987635	missense	probably damaging	1.00
R0531:4932438A13Rik	UTSW	3	37036825	missense	probably damaging	1.00
R0543:4932438A13Rik	UTSW	3	36996458	missense	probably benign	0.22
R0545:4932438A13Rik	UTSW	3	36987690	splice site	probably benign
R0674:4932438A13Rik	UTSW	3	37044626	missense	possibly damaging	0.86
R0745:4932438A13Rik	UTSW	3	36928463	missense	probably damaging	1.00
R0755:4932438A13Rik	UTSW	3	36946364	missense	probably damaging	1.00
R0785:4932438A13Rik	UTSW	3	36959334	splice site	probably benign
R1056:4932438A13Rik	UTSW	3	36983453	missense	possibly damaging	0.69
R1056:4932438A13Rik	UTSW	3	37044680	missense	probably benign	0.44
R1080:4932438A13Rik	UTSW	3	36988255	missense	probably damaging	1.00
R1103:4932438A13Rik	UTSW	3	36996523	missense	probably benign
R1119:4932438A13Rik	UTSW	3	36987045	missense	probably damaging	1.00
R1170:4932438A13Rik	UTSW	3	37044631	missense	probably damaging	0.98
R1183:4932438A13Rik	UTSW	3	36895303	missense	possibly damaging	0.51
R1186:4932438A13Rik	UTSW	3	36996312	unclassified	probably benign
R1201:4932438A13Rik	UTSW	3	36948375	missense	probably benign
R1219:4932438A13Rik	UTSW	3	36946470	nonsense	probably null
R1270:4932438A13Rik	UTSW	3	36952184	missense	probably damaging	1.00
R1273:4932438A13Rik	UTSW	3	36987210	missense	probably damaging	1.00
R1338:4932438A13Rik	UTSW	3	37052535	missense	unknown
R1364:4932438A13Rik	UTSW	3	36987030	missense	probably damaging	1.00
R1437:4932438A13Rik	UTSW	3	36942429	missense	possibly damaging	0.65
R1447:4932438A13Rik	UTSW	3	36965586	missense	probably damaging	0.98
R1467:4932438A13Rik	UTSW	3	37035945	missense	probably damaging	0.99
R1467:4932438A13Rik	UTSW	3	37035945	missense	probably damaging	0.99
R1470:4932438A13Rik	UTSW	3	36998331	missense	probably benign	0.31
R1470:4932438A13Rik	UTSW	3	36998331	missense	probably benign	0.31
R1481:4932438A13Rik	UTSW	3	37008434	missense	probably damaging	0.99
R1528:4932438A13Rik	UTSW	3	37052535	missense	unknown
R1533:4932438A13Rik	UTSW	3	37041375	missense	probably damaging	1.00
R1546:4932438A13Rik	UTSW	3	36870056	missense	possibly damaging	0.64
R1606:4932438A13Rik	UTSW	3	36942399	missense	probably damaging	1.00
R1638:4932438A13Rik	UTSW	3	37035812	nonsense	probably null
R1772:4932438A13Rik	UTSW	3	36959432	missense	probably damaging	1.00
R1896:4932438A13Rik	UTSW	3	36908231	nonsense	probably null
R1919:4932438A13Rik	UTSW	3	37006983	critical splice acceptor site	probably null
R1983:4932438A13Rik	UTSW	3	36887865	missense	probably null	1.00
R1987:4932438A13Rik	UTSW	3	36953985	critical splice donor site	probably null
R1992:4932438A13Rik	UTSW	3	37000032	missense	probably benign	0.32
R1999:4932438A13Rik	UTSW	3	36908211	missense	probably damaging	1.00
R2004:4932438A13Rik	UTSW	3	36895378	missense	possibly damaging	0.77
R2010:4932438A13Rik	UTSW	3	36928551	missense	probably benign	0.09
R2027:4932438A13Rik	UTSW	3	37047961	splice site	probably benign
R2039:4932438A13Rik	UTSW	3	37003878	missense	possibly damaging	0.66
R2054:4932438A13Rik	UTSW	3	36947853	missense	probably benign	0.01
R2089:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36953970	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2220:4932438A13Rik	UTSW	3	36875530	critical splice donor site	probably null
R2374:4932438A13Rik	UTSW	3	36885396	missense	probably benign	0.00
R2437:4932438A13Rik	UTSW	3	36958685	splice site	probably null
R2860:4932438A13Rik	UTSW	3	36965849	missense	probably damaging	1.00
R2861:4932438A13Rik	UTSW	3	36965849	missense	probably damaging	1.00
R2909:4932438A13Rik	UTSW	3	36947953	missense	probably damaging	1.00
R2925:4932438A13Rik	UTSW	3	37007122	missense	probably damaging	0.99
R2940:4932438A13Rik	UTSW	3	36958805	missense	probably damaging	1.00
R3015:4932438A13Rik	UTSW	3	36875462	missense	probably damaging	1.00
R3086:4932438A13Rik	UTSW	3	37011703	missense	possibly damaging	0.56
R3159:4932438A13Rik	UTSW	3	36959415	missense	probably benign	0.17
R3440:4932438A13Rik	UTSW	3	37041912	nonsense	probably null
R3703:4932438A13Rik	UTSW	3	36987581	missense	probably damaging	1.00
R3705:4932438A13Rik	UTSW	3	36987581	missense	probably damaging	1.00
R3795:4932438A13Rik	UTSW	3	37030565	missense	probably benign	0.30
R3820:4932438A13Rik	UTSW	3	37040434	missense	probably damaging	1.00
R3862:4932438A13Rik	UTSW	3	36885398	missense	possibly damaging	0.73
R3944:4932438A13Rik	UTSW	3	37030061	missense	possibly damaging	0.90
R4020:4932438A13Rik	UTSW	3	37012575	intron	probably benign
R4091:4932438A13Rik	UTSW	3	37030589	missense	probably benign	0.00
R4159:4932438A13Rik	UTSW	3	36931083	missense	probably benign	0.00
R4231:4932438A13Rik	UTSW	3	36920236	missense	probably benign	0.10
R4368:4932438A13Rik	UTSW	3	36988147	nonsense	probably null
R4413:4932438A13Rik	UTSW	3	36958681	splice site	probably null
R4475:4932438A13Rik	UTSW	3	37040395	missense	probably damaging	1.00
R4488:4932438A13Rik	UTSW	3	37003933	missense	probably null	0.93
R4489:4932438A13Rik	UTSW	3	37003933	missense	probably null	0.93
R4516:4932438A13Rik	UTSW	3	36895311	missense	possibly damaging	0.90
R4580:4932438A13Rik	UTSW	3	37030025	missense	probably benign	0.02
R4672:4932438A13Rik	UTSW	3	36889990	makesense	probably null
R4735:4932438A13Rik	UTSW	3	37004967	missense	possibly damaging	0.84
R4741:4932438A13Rik	UTSW	3	36942375	missense	probably damaging	0.99
R4754:4932438A13Rik	UTSW	3	37022466	nonsense	probably null
R4778:4932438A13Rik	UTSW	3	36937065	missense	possibly damaging	0.90
R4833:4932438A13Rik	UTSW	3	36964968	missense	probably damaging	0.96
R4896:4932438A13Rik	UTSW	3	36965937	missense	probably damaging	1.00
R4910:4932438A13Rik	UTSW	3	36998199	missense	probably damaging	1.00
R4922:4932438A13Rik	UTSW	3	36987165	missense	probably damaging	1.00
R4941:4932438A13Rik	UTSW	3	36917702	missense	probably damaging	1.00
R4941:4932438A13Rik	UTSW	3	36919901	missense	probably benign	0.41
R4980:4932438A13Rik	UTSW	3	36943312	missense	probably damaging	1.00
R5030:4932438A13Rik	UTSW	3	36943399	intron	probably benign
R5049:4932438A13Rik	UTSW	3	37040506	intron	probably benign
R5049:4932438A13Rik	UTSW	3	37041390	missense	probably damaging	1.00
R5089:4932438A13Rik	UTSW	3	36987502	missense	probably benign	0.02
R5092:4932438A13Rik	UTSW	3	37000085	missense	probably benign	0.14
R5122:4932438A13Rik	UTSW	3	37034757	splice site	probably null
R5210:4932438A13Rik	UTSW	3	37033265	missense	possibly damaging	0.85
R5246:4932438A13Rik	UTSW	3	37048050	missense	probably damaging	1.00
R5289:4932438A13Rik	UTSW	3	37000109	missense	probably damaging	0.97
R5348:4932438A13Rik	UTSW	3	37048146	missense	probably damaging	1.00
R5394:4932438A13Rik	UTSW	3	36917668	missense	probably damaging	1.00
R5434:4932438A13Rik	UTSW	3	36875516	missense	probably damaging	1.00
R5667:4932438A13Rik	UTSW	3	36917677	missense	probably benign	0.00
R5686:4932438A13Rik	UTSW	3	36917660	missense	probably benign	0.00
R5701:4932438A13Rik	UTSW	3	36921360	missense	probably benign	0.10
R5778:4932438A13Rik	UTSW	3	36958714	missense	probably damaging	1.00
R5787:4932438A13Rik	UTSW	3	36992733	splice site	probably null
R5800:4932438A13Rik	UTSW	3	37052443	missense	probably damaging	1.00
R5819:4932438A13Rik	UTSW	3	37048600	missense	probably benign	0.12
R5820:4932438A13Rik	UTSW	3	37039526	missense	probably benign	0.00
R5952:4932438A13Rik	UTSW	3	36965621	missense	probably damaging	1.00
R5975:4932438A13Rik	UTSW	3	36969221	missense	possibly damaging	0.64
R5996:4932438A13Rik	UTSW	3	36931116	missense	probably benign	0.07
R6192:4932438A13Rik	UTSW	3	36988169	missense	probably benign	0.00
R6225:4932438A13Rik	UTSW	3	36948304	missense	probably damaging	1.00
R6234:4932438A13Rik	UTSW	3	36983471	missense	probably benign	0.00
R6244:4932438A13Rik	UTSW	3	36956999	missense	probably benign
R6263:4932438A13Rik	UTSW	3	36931111	missense	probably benign	0.06
R6351:4932438A13Rik	UTSW	3	36908228	missense	probably damaging	1.00
R6380:4932438A13Rik	UTSW	3	37033307	missense	probably benign	0.19
R6468:4932438A13Rik	UTSW	3	37008443	missense	probably damaging	1.00
R6759:4932438A13Rik	UTSW	3	36988085	missense	possibly damaging	0.81
R6792:4932438A13Rik	UTSW	3	37011566	critical splice acceptor site	probably null
R6809:4932438A13Rik	UTSW	3	36874282	missense	probably damaging	0.98
R6841:4932438A13Rik	UTSW	3	37021481	missense	probably damaging	1.00
R6959:4932438A13Rik	UTSW	3	36967189	missense	probably damaging	1.00
R7102:4932438A13Rik	UTSW	3	36940798	missense	probably damaging	0.99
R7188:4932438A13Rik	UTSW	3	36950013	missense	probably benign	0.06
R7212:4932438A13Rik	UTSW	3	37048009	missense
R7425:4932438A13Rik	UTSW	3	36948341	missense	probably benign
R7425:4932438A13Rik	UTSW	3	36983394	missense	probably benign	0.02
R7451:4932438A13Rik	UTSW	3	37022807	splice site	probably null
R7604:4932438A13Rik	UTSW	3	36949843	splice site	probably null
R7622:4932438A13Rik	UTSW	3	36948413	nonsense	probably null
R7671:4932438A13Rik	UTSW	3	36943231	missense	probably damaging	0.99
R7699:4932438A13Rik	UTSW	3	36974172	missense	possibly damaging	0.67
R7699:4932438A13Rik	UTSW	3	37026154	missense	probably benign	0.00
R7700:4932438A13Rik	UTSW	3	36974172	missense	possibly damaging	0.67
R7700:4932438A13Rik	UTSW	3	37026154	missense	probably benign	0.00
R7748:4932438A13Rik	UTSW	3	36959335	critical splice acceptor site	probably null
R7767:4932438A13Rik	UTSW	3	36920287	critical splice donor site	probably null
R7787:4932438A13Rik	UTSW	3	36885408	missense	probably damaging	1.00
R7830:4932438A13Rik	UTSW	3	36964932	frame shift	probably null
R7849:4932438A13Rik	UTSW	3	37026328	missense
R7912:4932438A13Rik	UTSW	3	37007069	missense	probably damaging	0.99
R7914:4932438A13Rik	UTSW	3	36946283	missense	probably benign	0.13
R7945:4932438A13Rik	UTSW	3	36965893	missense	probably benign	0.03
R8039:4932438A13Rik	UTSW	3	36943214	missense	probably benign	0.12
R8101:4932438A13Rik	UTSW	3	37008502	missense	probably damaging	1.00
R8143:4932438A13Rik	UTSW	3	36946508	critical splice donor site	probably null
R8145:4932438A13Rik	UTSW	3	36998267	missense	probably damaging	1.00
R8171:4932438A13Rik	UTSW	3	36975713	missense	probably benign	0.00
R8210:4932438A13Rik	UTSW	3	37012881	missense
R8250:4932438A13Rik	UTSW	3	36917662	missense	probably damaging	0.99
R8369:4932438A13Rik	UTSW	3	37011603	missense
R8478:4932438A13Rik	UTSW	3	37033277	missense	possibly damaging	0.74
R8558:4932438A13Rik	UTSW	3	37048601	missense
R8688:4932438A13Rik	UTSW	3	37035917	missense
R8724:4932438A13Rik	UTSW	3	36890893	missense	probably damaging	0.99
R8818:4932438A13Rik	UTSW	3	36996548	missense	possibly damaging	0.60
R8869:4932438A13Rik	UTSW	3	36958858	missense	probably damaging	0.99
R8887:4932438A13Rik	UTSW	3	37033354	missense	possibly damaging	0.95
R8899:4932438A13Rik	UTSW	3	36988280	missense	probably damaging	1.00
R8907:4932438A13Rik	UTSW	3	36948146	nonsense	probably null
R8960:4932438A13Rik	UTSW	3	37012983	missense	probably damaging	1.00
R8990:4932438A13Rik	UTSW	3	36921221	missense	possibly damaging	0.60
R9021:4932438A13Rik	UTSW	3	36998344	missense	probably benign	0.00
R9048:4932438A13Rik	UTSW	3	37011777	missense
R9100:4932438A13Rik	UTSW	3	37044758	missense
R9166:4932438A13Rik	UTSW	3	36987367	missense	probably damaging	1.00
R9176:4932438A13Rik	UTSW	3	36956703	missense	possibly damaging	0.82
R9202:4932438A13Rik	UTSW	3	36890821	missense	probably benign
R9303:4932438A13Rik	UTSW	3	37044820	missense
R9305:4932438A13Rik	UTSW	3	37044820	missense
R9332:4932438A13Rik	UTSW	3	37050840	missense
R9362:4932438A13Rik	UTSW	3	36957013	missense	probably benign
R9493:4932438A13Rik	UTSW	3	37011736	missense
R9534:4932438A13Rik	UTSW	3	36998270	missense	probably benign	0.01
R9569:4932438A13Rik	UTSW	3	37012621	missense
R9593:4932438A13Rik	UTSW	3	36947941	missense	probably damaging	1.00
R9600:4932438A13Rik	UTSW	3	37041416	nonsense	probably null
R9733:4932438A13Rik	UTSW	3	37048583	missense
R9751:4932438A13Rik	UTSW	3	37011740	missense
RF013:4932438A13Rik	UTSW	3	37050757	critical splice acceptor site	probably benign
RF015:4932438A13Rik	UTSW	3	37050748	critical splice acceptor site	probably benign
RF021:4932438A13Rik	UTSW	3	37050748	critical splice acceptor site	probably benign
RF023:4932438A13Rik	UTSW	3	37050760	critical splice acceptor site	probably benign
RF034:4932438A13Rik	UTSW	3	37050760	critical splice acceptor site	probably benign
RF035:4932438A13Rik	UTSW	3	37050758	critical splice acceptor site	probably benign
RF055:4932438A13Rik	UTSW	3	37050757	critical splice acceptor site	probably benign
X0050:4932438A13Rik	UTSW	3	36957128	missense	probably damaging	1.00
Z1088:4932438A13Rik	UTSW	3	36987567	missense	probably damaging	1.00
Z1177:4932438A13Rik	UTSW	3	36919950	missense	probably benign
Z1177:4932438A13Rik	UTSW	3	36983440	missense	possibly damaging	0.88
Z1177:4932438A13Rik	UTSW	3	37036707	missense

Predicted Primers

PCR Primer
(F):5'- GCAGGGGAGGATAATTACTTTTGC -3'
(R):5'- GGAACACAGTCAGTTTTCTGC -3'

Sequencing Primer
(F):5'- ATTTTTGTGCATGGAGATTTGAAATG -3'
(R):5'- AGTCAGTTTTCTGCTGAGTGGAC -3'

Posted On

2015-10-21