Incidental Mutation 'R4705:Abca4'
ID355095
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene NameATP-binding cassette, sub-family A (ABC1), member 4
SynonymsD430003I15Rik, Abc10, Rim protein, RmP
MMRRC Submission 041953-MU
Accession Numbers

Genbank: NM_007378; MGI: 109424

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4705 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122044443-122180123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122105370 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 667 (V667A)
Ref Sequence ENSEMBL: ENSMUSP00000013995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995]
Predicted Effect probably damaging
Transcript: ENSMUST00000013995
AA Change: V667A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: V667A

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 96% (113/118)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,635 N325D possibly damaging Het
1700056E22Rik A G 1: 184,033,172 V230A possibly damaging Het
2010315B03Rik T C 9: 124,294,001 T123A possibly damaging Het
4932438A13Rik C T 3: 37,041,889 T1108I probably benign Het
Abcb5 A G 12: 118,965,305 S4P possibly damaging Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Ahnak C A 19: 9,016,906 H5185N probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
Atf7ip C T 6: 136,561,194 P483L probably damaging Het
Atp11a C G 8: 12,813,118 P99R probably damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bag6 C A 17: 35,142,343 P476H probably damaging Het
BC049730 T A 7: 24,713,509 L114Q probably damaging Het
C2cd3 A G 7: 100,395,188 K326E possibly damaging Het
Casp1 A G 9: 5,306,204 D363G probably damaging Het
Ccdc33 G T 9: 58,117,557 Q129K probably benign Het
Ccdc88a T C 11: 29,422,586 I107T probably benign Het
Cela2a T C 4: 141,821,411 N138S probably benign Het
Cfap61 A C 2: 146,035,202 R460S probably damaging Het
Clstn2 T C 9: 97,463,559 N579D possibly damaging Het
Col13a1 C A 10: 61,850,165 G683W unknown Het
Col4a2 G A 8: 11,313,504 R14Q possibly damaging Het
Cpa6 A G 1: 10,481,058 S164P probably benign Het
Cpq A G 15: 33,497,338 N408S probably benign Het
Ctnnal1 T C 4: 56,812,579 T690A probably benign Het
Cx3cl1 A T 8: 94,780,207 N280I probably benign Het
Cyp2b19 C T 7: 26,757,292 R36C probably benign Het
Ddx51 T C 5: 110,655,308 V269A probably damaging Het
Dlst G T 12: 85,118,842 probably null Het
Dmkn G C 7: 30,763,981 A20P probably damaging Het
Dnhd1 T C 7: 105,655,741 I330T probably damaging Het
Dock3 G A 9: 107,025,336 H292Y probably damaging Het
Ell A G 8: 70,578,934 D94G possibly damaging Het
Enam T A 5: 88,503,791 L1053* probably null Het
Fcgbp A G 7: 28,107,296 K2230E probably benign Het
Frmd5 G T 2: 121,562,863 probably benign Het
Gas2l1 G A 11: 5,060,867 S654L possibly damaging Het
Gltpd2 G T 11: 70,520,140 E86* probably null Het
Glyat T C 19: 12,651,297 L152P possibly damaging Het
Gm17330 T C 12: 23,968,782 T22A probably damaging Het
Gm9931 T A 1: 147,281,853 noncoding transcript Het
Gpatch1 A T 7: 35,299,305 probably null Het
Gpr4 T C 7: 19,222,894 L247P probably damaging Het
Gtpbp3 G A 8: 71,491,114 E214K probably benign Het
Hdac7 G T 15: 97,811,587 Q21K probably damaging Het
Hivep3 A G 4: 119,872,050 probably benign Het
Hk2 C T 6: 82,739,650 M300I possibly damaging Het
Ighv1-61 T C 12: 115,359,279 Y71C probably damaging Het
Il1f8 T C 2: 24,154,618 V10A probably benign Het
Inpp5f G T 7: 128,663,987 S152I probably damaging Het
Jag1 C A 2: 137,096,309 W257L probably damaging Het
Jak2 T A 19: 29,294,915 N612K possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kbtbd6 A G 14: 79,452,606 D247G probably benign Het
Kif15 A G 9: 122,959,993 probably null Het
Kndc1 A G 7: 139,930,123 T1293A possibly damaging Het
Lpar5 T C 6: 125,082,207 I297T possibly damaging Het
Lpin2 T A 17: 71,232,143 probably benign Het
Mfsd4a A T 1: 132,053,571 L230Q probably damaging Het
Mmp8 T C 9: 7,565,549 V313A probably benign Het
Mrpl19 A T 6: 81,964,285 D98E probably damaging Het
Mybl1 A G 1: 9,690,115 I86T probably damaging Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Necab1 T C 4: 15,052,628 T117A probably damaging Het
Nol11 A G 11: 107,184,718 probably benign Het
Nucb2 G A 7: 116,540,027 probably null Het
Nupl1 G T 14: 60,251,215 P19T unknown Het
Odf2 T A 2: 29,904,034 L301Q probably damaging Het
Oit1 T C 14: 8,349,347 E201G probably benign Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr736 A G 14: 50,392,800 I15V probably benign Het
Oog4 T C 4: 143,438,875 Y234C probably benign Het
Papln T C 12: 83,777,208 probably null Het
Paqr6 C T 3: 88,365,929 A76V probably benign Het
Pclo A G 5: 14,676,480 probably benign Het
Pdzd8 T C 19: 59,345,311 T93A possibly damaging Het
Pkdrej A T 15: 85,821,167 Y189* probably null Het
Pknox2 A T 9: 36,923,638 N178K possibly damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plxnd1 A C 6: 115,958,620 L1735R probably damaging Het
Polm T A 11: 5,837,663 D30V possibly damaging Het
Rap1gap2 T A 11: 74,437,439 I100F probably damaging Het
Rasgef1c T A 11: 49,978,467 W414R probably benign Het
Rassf1 A G 9: 107,557,867 D187G probably benign Het
Rhag T C 17: 40,836,438 I397T probably benign Het
Rnft2 A G 5: 118,228,863 F269S probably damaging Het
Rnmt T C 18: 68,314,125 F360S probably damaging Het
Ror2 C T 13: 53,117,297 A329T probably benign Het
Slc4a1 T A 11: 102,356,258 N501I possibly damaging Het
Slc4a7 T A 14: 14,733,856 S89T probably damaging Het
Sptbn1 G A 11: 30,100,660 H2310Y probably benign Het
Tbc1d9b C A 11: 50,140,462 N103K probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tmem100 C T 11: 90,035,563 T72I probably damaging Het
Ttc38 A G 15: 85,852,963 T350A probably benign Het
Ubr4 C T 4: 139,450,529 T3241M probably damaging Het
Unc13d A T 11: 116,073,388 M350K possibly damaging Het
Vit T C 17: 78,625,114 I550T probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Zbtb12 T A 17: 34,896,401 H387Q possibly damaging Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 122062704 splice site probably null
IGL00229:Abca4 APN 3 122170954 missense probably damaging 1.00
IGL00858:Abca4 APN 3 122173888 missense probably damaging 0.97
IGL01316:Abca4 APN 3 122141755 missense probably damaging 0.99
IGL01357:Abca4 APN 3 122103583 missense probably damaging 1.00
IGL01784:Abca4 APN 3 122138505 missense probably benign 0.22
IGL01903:Abca4 APN 3 122155401 splice site probably benign
IGL02008:Abca4 APN 3 122176101 missense probably benign 0.00
IGL02113:Abca4 APN 3 122110478 missense possibly damaging 0.90
IGL02142:Abca4 APN 3 122169926 missense probably benign 0.01
IGL02200:Abca4 APN 3 122069014 missense probably benign 0.00
IGL02203:Abca4 APN 3 122179808 missense probably benign
IGL02306:Abca4 APN 3 122158395 missense probably damaging 1.00
IGL02307:Abca4 APN 3 122141746 missense probably damaging 1.00
IGL02673:Abca4 APN 3 122103501 missense probably damaging 1.00
IGL02864:Abca4 APN 3 122143431 missense probably damaging 1.00
IGL02886:Abca4 APN 3 122128214 missense probably damaging 0.96
IGL02934:Abca4 APN 3 122162359 nonsense probably null
IGL02992:Abca4 APN 3 122128286 missense probably damaging 0.96
IGL03083:Abca4 APN 3 122138612 critical splice donor site probably null
IGL03258:Abca4 APN 3 122137561 splice site probably benign
IGL03279:Abca4 APN 3 122141732 missense probably benign 0.12
3-1:Abca4 UTSW 3 122080925 missense probably benign 0.01
B6819:Abca4 UTSW 3 122103624 splice site probably benign
K7894:Abca4 UTSW 3 122147868 frame shift probably null
PIT4151001:Abca4 UTSW 3 122137021 missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 122105316 missense probably damaging 0.99
R0001:Abca4 UTSW 3 122081011 splice site probably benign
R0091:Abca4 UTSW 3 122138530 missense possibly damaging 0.94
R0138:Abca4 UTSW 3 122105449 missense probably damaging 1.00
R0344:Abca4 UTSW 3 122083964 missense probably damaging 1.00
R0347:Abca4 UTSW 3 122120099 missense probably benign 0.00
R0508:Abca4 UTSW 3 122123551 splice site probably benign
R0607:Abca4 UTSW 3 122156432 missense probably damaging 1.00
R0835:Abca4 UTSW 3 122126213 missense probably damaging 1.00
R0839:Abca4 UTSW 3 122126878 missense probably damaging 0.99
R1138:Abca4 UTSW 3 122173848 missense probably benign 0.13
R1448:Abca4 UTSW 3 122162928 splice site probably null
R1453:Abca4 UTSW 3 122069114 missense probably benign 0.04
R1533:Abca4 UTSW 3 122135158 missense probably benign 0.07
R1645:Abca4 UTSW 3 122155277 missense probably benign 0.00
R1763:Abca4 UTSW 3 122110681 missense probably benign 0.09
R1763:Abca4 UTSW 3 122163830 missense probably damaging 1.00
R1838:Abca4 UTSW 3 122128305 missense probably benign
R1867:Abca4 UTSW 3 122105361 missense probably damaging 1.00
R1907:Abca4 UTSW 3 122069012 missense probably damaging 0.99
R1935:Abca4 UTSW 3 122052923 missense probably benign 0.00
R1936:Abca4 UTSW 3 122052923 missense probably benign 0.00
R2165:Abca4 UTSW 3 122112399 missense possibly damaging 0.90
R2391:Abca4 UTSW 3 122158422 missense probably benign 0.00
R2403:Abca4 UTSW 3 122170943 missense probably damaging 1.00
R3788:Abca4 UTSW 3 122052912 missense possibly damaging 0.50
R3814:Abca4 UTSW 3 122170921 splice site probably benign
R4554:Abca4 UTSW 3 122156343 missense possibly damaging 0.91
R4649:Abca4 UTSW 3 122169893 missense probably damaging 1.00
R4653:Abca4 UTSW 3 122138581 nonsense probably null
R4655:Abca4 UTSW 3 122147498 missense possibly damaging 0.93
R4668:Abca4 UTSW 3 122155299 missense possibly damaging 0.90
R4788:Abca4 UTSW 3 122166712 missense probably damaging 1.00
R4795:Abca4 UTSW 3 122176123 missense probably damaging 0.99
R4999:Abca4 UTSW 3 122105370 missense probably damaging 1.00
R5301:Abca4 UTSW 3 122102853 missense probably damaging 0.96
R5372:Abca4 UTSW 3 122055339 missense probably damaging 0.96
R5395:Abca4 UTSW 3 122080941 missense probably benign 0.00
R5539:Abca4 UTSW 3 122169908 missense probably damaging 1.00
R5583:Abca4 UTSW 3 122148901 missense probably damaging 0.99
R5706:Abca4 UTSW 3 122054261 missense probably benign 0.10
R5719:Abca4 UTSW 3 122135266 critical splice donor site probably null
R5731:Abca4 UTSW 3 122132593 missense probably damaging 1.00
R5802:Abca4 UTSW 3 122054232 missense probably damaging 1.00
R5819:Abca4 UTSW 3 122136981 missense probably damaging 0.97
R5853:Abca4 UTSW 3 122103531 missense probably benign
R6053:Abca4 UTSW 3 122171017 missense probably damaging 0.99
R6135:Abca4 UTSW 3 122138447 missense possibly damaging 0.69
R6185:Abca4 UTSW 3 122126140 missense probably damaging 0.97
R6227:Abca4 UTSW 3 122137094 nonsense probably null
R6293:Abca4 UTSW 3 122141746 missense probably damaging 1.00
R6297:Abca4 UTSW 3 122132530 missense probably benign 0.24
R6367:Abca4 UTSW 3 122103580 missense probably damaging 1.00
R6376:Abca4 UTSW 3 122123660 missense possibly damaging 0.95
R6405:Abca4 UTSW 3 122173662 intron probably null
R6525:Abca4 UTSW 3 122137659 missense probably benign 0.00
R6602:Abca4 UTSW 3 122138501 missense probably benign 0.00
R6681:Abca4 UTSW 3 122121798 missense probably damaging 1.00
R6747:Abca4 UTSW 3 122126313 intron probably null
R6852:Abca4 UTSW 3 122135195 missense probably damaging 0.99
R7049:Abca4 UTSW 3 122147848 missense probably benign 0.00
R7072:Abca4 UTSW 3 122173943 missense probably damaging 1.00
R7092:Abca4 UTSW 3 122138569 missense probably damaging 1.00
R7110:Abca4 UTSW 3 122132643 missense probably damaging 1.00
R7138:Abca4 UTSW 3 122105464 nonsense probably null
R7172:Abca4 UTSW 3 122103540 nonsense probably null
R7263:Abca4 UTSW 3 122054194 missense probably damaging 0.99
R7414:Abca4 UTSW 3 122102738 missense probably benign 0.28
R7537:Abca4 UTSW 3 122173988 missense possibly damaging 0.68
R7577:Abca4 UTSW 3 122174014 missense probably damaging 1.00
R7665:Abca4 UTSW 3 122044490 start gained probably benign
R7758:Abca4 UTSW 3 122128167 missense probably damaging 1.00
R7944:Abca4 UTSW 3 122069248 intron probably null
Z1176:Abca4 UTSW 3 122103488 missense probably damaging 1.00
Z1176:Abca4 UTSW 3 122156443 missense probably damaging 1.00
Z1177:Abca4 UTSW 3 122147786 missense possibly damaging 0.79
Z1177:Abca4 UTSW 3 122173914 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AAAGGTATTTAAGAGGGCTCAACC -3'
(R):5'- AAAGACTGTCTTCTCCACCCG -3'

Sequencing Primer
(F):5'- AGGGTCCAACGATTTATTTTTCTGC -3'
(R):5'- GGCTTACCATGATGAACAGCGTC -3'
Posted On2015-10-21