Incidental Mutation 'R4705:Ubr4'
ID355099
Institutional Source Beutler Lab
Gene Symbol Ubr4
Ensembl Gene ENSMUSG00000066036
Gene Nameubiquitin protein ligase E3 component n-recognin 4
SynonymsLOC381562, D930005K06Rik, Zubr1, p600, 1810009A16Rik, A930005E13Rik
MMRRC Submission 041953-MU
Accession Numbers

Ncbi RefSeq: NM_001160319.1; MGI:1916366

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4705 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location139352609-139489588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139450529 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 3241 (T3241M)
Ref Sequence ENSEMBL: ENSMUSP00000125800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000147999] [ENSMUST00000165860]
Predicted Effect probably damaging
Transcript: ENSMUST00000097822
AA Change: T3265M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036
AA Change: T3265M

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1660 1725 1.9e-9 PFAM
Blast:ZnF_C2H2 1966 1991 6e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2502 2540 N/A INTRINSIC
low complexity region 2725 2735 N/A INTRINSIC
low complexity region 2818 2852 N/A INTRINSIC
low complexity region 2887 2905 N/A INTRINSIC
low complexity region 2928 2942 N/A INTRINSIC
low complexity region 2945 2959 N/A INTRINSIC
low complexity region 2966 2986 N/A INTRINSIC
low complexity region 3063 3091 N/A INTRINSIC
low complexity region 3329 3385 N/A INTRINSIC
low complexity region 3776 3788 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4364 5160 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129949
AA Change: T1952M
SMART Domains Protein: ENSMUSP00000115711
Gene: ENSMUSG00000066036
AA Change: T1952M

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:zf-UBR 372 437 2.1e-10 PFAM
Blast:ZnF_C2H2 678 703 5e-8 BLAST
low complexity region 980 991 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1448 1458 N/A INTRINSIC
low complexity region 1575 1593 N/A INTRINSIC
low complexity region 1616 1630 N/A INTRINSIC
low complexity region 1633 1647 N/A INTRINSIC
low complexity region 1654 1674 N/A INTRINSIC
low complexity region 1751 1779 N/A INTRINSIC
low complexity region 2017 2045 N/A INTRINSIC
low complexity region 2048 2065 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147999
AA Change: T106M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036
AA Change: T106M

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165860
AA Change: T3241M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036
AA Change: T3241M

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1659 1729 4e-13 PFAM
Blast:ZnF_C2H2 1966 1991 5e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2513 2551 N/A INTRINSIC
low complexity region 2736 2746 N/A INTRINSIC
low complexity region 2863 2881 N/A INTRINSIC
low complexity region 2904 2918 N/A INTRINSIC
low complexity region 2921 2935 N/A INTRINSIC
low complexity region 2942 2962 N/A INTRINSIC
low complexity region 3039 3067 N/A INTRINSIC
low complexity region 3305 3361 N/A INTRINSIC
low complexity region 3752 3764 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4340 5136 N/A PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 96% (113/118)
MGI Phenotype Strain: 5286698
Lethality: D1-D5
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,635 N325D possibly damaging Het
1700056E22Rik A G 1: 184,033,172 V230A possibly damaging Het
2010315B03Rik T C 9: 124,294,001 T123A possibly damaging Het
4932438A13Rik C T 3: 37,041,889 T1108I probably benign Het
Abca4 T C 3: 122,105,370 V667A probably damaging Het
Abcb5 A G 12: 118,965,305 S4P possibly damaging Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Ahnak C A 19: 9,016,906 H5185N probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
Atf7ip C T 6: 136,561,194 P483L probably damaging Het
Atp11a C G 8: 12,813,118 P99R probably damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bag6 C A 17: 35,142,343 P476H probably damaging Het
BC049730 T A 7: 24,713,509 L114Q probably damaging Het
C2cd3 A G 7: 100,395,188 K326E possibly damaging Het
Casp1 A G 9: 5,306,204 D363G probably damaging Het
Ccdc33 G T 9: 58,117,557 Q129K probably benign Het
Ccdc88a T C 11: 29,422,586 I107T probably benign Het
Cela2a T C 4: 141,821,411 N138S probably benign Het
Cfap61 A C 2: 146,035,202 R460S probably damaging Het
Clstn2 T C 9: 97,463,559 N579D possibly damaging Het
Col13a1 C A 10: 61,850,165 G683W unknown Het
Col4a2 G A 8: 11,313,504 R14Q possibly damaging Het
Cpa6 A G 1: 10,481,058 S164P probably benign Het
Cpq A G 15: 33,497,338 N408S probably benign Het
Ctnnal1 T C 4: 56,812,579 T690A probably benign Het
Cx3cl1 A T 8: 94,780,207 N280I probably benign Het
Cyp2b19 C T 7: 26,757,292 R36C probably benign Het
Ddx51 T C 5: 110,655,308 V269A probably damaging Het
Dlst G T 12: 85,118,842 probably null Het
Dmkn G C 7: 30,763,981 A20P probably damaging Het
Dnhd1 T C 7: 105,655,741 I330T probably damaging Het
Dock3 G A 9: 107,025,336 H292Y probably damaging Het
Ell A G 8: 70,578,934 D94G possibly damaging Het
Enam T A 5: 88,503,791 L1053* probably null Het
Fcgbp A G 7: 28,107,296 K2230E probably benign Het
Frmd5 G T 2: 121,562,863 probably benign Het
Gas2l1 G A 11: 5,060,867 S654L possibly damaging Het
Gltpd2 G T 11: 70,520,140 E86* probably null Het
Glyat T C 19: 12,651,297 L152P possibly damaging Het
Gm17330 T C 12: 23,968,782 T22A probably damaging Het
Gm9931 T A 1: 147,281,853 noncoding transcript Het
Gpatch1 A T 7: 35,299,305 probably null Het
Gpr4 T C 7: 19,222,894 L247P probably damaging Het
Gtpbp3 G A 8: 71,491,114 E214K probably benign Het
Hdac7 G T 15: 97,811,587 Q21K probably damaging Het
Hivep3 A G 4: 119,872,050 probably benign Het
Hk2 C T 6: 82,739,650 M300I possibly damaging Het
Ighv1-61 T C 12: 115,359,279 Y71C probably damaging Het
Il1f8 T C 2: 24,154,618 V10A probably benign Het
Inpp5f G T 7: 128,663,987 S152I probably damaging Het
Jag1 C A 2: 137,096,309 W257L probably damaging Het
Jak2 T A 19: 29,294,915 N612K possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kbtbd6 A G 14: 79,452,606 D247G probably benign Het
Kif15 A G 9: 122,959,993 probably null Het
Kndc1 A G 7: 139,930,123 T1293A possibly damaging Het
Lpar5 T C 6: 125,082,207 I297T possibly damaging Het
Lpin2 T A 17: 71,232,143 probably benign Het
Mfsd4a A T 1: 132,053,571 L230Q probably damaging Het
Mmp8 T C 9: 7,565,549 V313A probably benign Het
Mrpl19 A T 6: 81,964,285 D98E probably damaging Het
Mybl1 A G 1: 9,690,115 I86T probably damaging Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Necab1 T C 4: 15,052,628 T117A probably damaging Het
Nol11 A G 11: 107,184,718 probably benign Het
Nucb2 G A 7: 116,540,027 probably null Het
Nupl1 G T 14: 60,251,215 P19T unknown Het
Odf2 T A 2: 29,904,034 L301Q probably damaging Het
Oit1 T C 14: 8,349,347 E201G probably benign Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr736 A G 14: 50,392,800 I15V probably benign Het
Oog4 T C 4: 143,438,875 Y234C probably benign Het
Papln T C 12: 83,777,208 probably null Het
Paqr6 C T 3: 88,365,929 A76V probably benign Het
Pclo A G 5: 14,676,480 probably benign Het
Pdzd8 T C 19: 59,345,311 T93A possibly damaging Het
Pkdrej A T 15: 85,821,167 Y189* probably null Het
Pknox2 A T 9: 36,923,638 N178K possibly damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plxnd1 A C 6: 115,958,620 L1735R probably damaging Het
Polm T A 11: 5,837,663 D30V possibly damaging Het
Rap1gap2 T A 11: 74,437,439 I100F probably damaging Het
Rasgef1c T A 11: 49,978,467 W414R probably benign Het
Rassf1 A G 9: 107,557,867 D187G probably benign Het
Rhag T C 17: 40,836,438 I397T probably benign Het
Rnft2 A G 5: 118,228,863 F269S probably damaging Het
Rnmt T C 18: 68,314,125 F360S probably damaging Het
Ror2 C T 13: 53,117,297 A329T probably benign Het
Slc4a1 T A 11: 102,356,258 N501I possibly damaging Het
Slc4a7 T A 14: 14,733,856 S89T probably damaging Het
Sptbn1 G A 11: 30,100,660 H2310Y probably benign Het
Tbc1d9b C A 11: 50,140,462 N103K probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tmem100 C T 11: 90,035,563 T72I probably damaging Het
Ttc38 A G 15: 85,852,963 T350A probably benign Het
Unc13d A T 11: 116,073,388 M350K possibly damaging Het
Vit T C 17: 78,625,114 I550T probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Zbtb12 T A 17: 34,896,401 H387Q possibly damaging Het
Other mutations in Ubr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ubr4 APN 4 139465322 missense possibly damaging 0.46
IGL00336:Ubr4 APN 4 139428566 missense probably damaging 1.00
IGL00586:Ubr4 APN 4 139455184 missense possibly damaging 0.95
IGL00659:Ubr4 APN 4 139421245 missense probably damaging 1.00
IGL00766:Ubr4 APN 4 139440766 missense probably damaging 1.00
IGL00819:Ubr4 APN 4 139476282 missense possibly damaging 0.92
IGL00833:Ubr4 APN 4 139393159 critical splice donor site probably null
IGL01126:Ubr4 APN 4 139402555 missense probably benign 0.04
IGL01311:Ubr4 APN 4 139479045 missense possibly damaging 0.66
IGL01349:Ubr4 APN 4 139480728 missense unknown
IGL01388:Ubr4 APN 4 139460243 missense possibly damaging 0.76
IGL01417:Ubr4 APN 4 139410800 missense probably damaging 0.99
IGL01446:Ubr4 APN 4 139438040 splice site probably benign
IGL01449:Ubr4 APN 4 139412736 missense probably damaging 0.98
IGL01545:Ubr4 APN 4 139442829 splice site probably benign
IGL01568:Ubr4 APN 4 139421373 missense probably damaging 1.00
IGL01596:Ubr4 APN 4 139462534 splice site probably benign
IGL01621:Ubr4 APN 4 139440783 nonsense probably null
IGL01639:Ubr4 APN 4 139417344 missense probably damaging 0.99
IGL01655:Ubr4 APN 4 139407796 missense probably damaging 1.00
IGL01710:Ubr4 APN 4 139418461 missense possibly damaging 0.81
IGL01830:Ubr4 APN 4 139472500 missense probably damaging 0.99
IGL01862:Ubr4 APN 4 139477158 missense possibly damaging 0.66
IGL01868:Ubr4 APN 4 139412678 nonsense probably null
IGL01874:Ubr4 APN 4 139393289 splice site probably benign
IGL01889:Ubr4 APN 4 139462472 nonsense probably null
IGL01891:Ubr4 APN 4 139436260 critical splice donor site probably null
IGL01980:Ubr4 APN 4 139429602 missense probably damaging 0.99
IGL02126:Ubr4 APN 4 139452741 critical splice donor site probably null
IGL02153:Ubr4 APN 4 139460160 nonsense probably null
IGL02173:Ubr4 APN 4 139437070 splice site probably null
IGL02214:Ubr4 APN 4 139428583 missense possibly damaging 0.95
IGL02214:Ubr4 APN 4 139461827 critical splice acceptor site probably null
IGL02220:Ubr4 APN 4 139388435 missense probably benign 0.01
IGL02246:Ubr4 APN 4 139459103 missense possibly damaging 0.89
IGL02264:Ubr4 APN 4 139455628 nonsense probably null
IGL02273:Ubr4 APN 4 139472578 missense possibly damaging 0.94
IGL02316:Ubr4 APN 4 139473178 missense possibly damaging 0.46
IGL02328:Ubr4 APN 4 139478922 missense probably damaging 0.97
IGL02476:Ubr4 APN 4 139421249 nonsense probably null
IGL02477:Ubr4 APN 4 139436205 missense probably damaging 0.98
IGL02544:Ubr4 APN 4 139415118 missense probably damaging 1.00
IGL02622:Ubr4 APN 4 139467250 nonsense probably null
IGL02679:Ubr4 APN 4 139459134 missense probably damaging 0.99
IGL02728:Ubr4 APN 4 139468811 missense probably damaging 1.00
IGL02754:Ubr4 APN 4 139410784 missense probably damaging 0.99
IGL02754:Ubr4 APN 4 139393159 critical splice donor site probably null
IGL02892:Ubr4 APN 4 139417331 missense probably damaging 0.96
IGL02897:Ubr4 APN 4 139472508 missense probably damaging 0.97
IGL02946:Ubr4 APN 4 139425295 missense probably damaging 1.00
IGL02964:Ubr4 APN 4 139407820 missense possibly damaging 0.84
IGL03059:Ubr4 APN 4 139480676 missense probably damaging 0.98
IGL03068:Ubr4 APN 4 139409730 missense probably benign 0.02
IGL03087:Ubr4 APN 4 139450357 nonsense probably null
IGL03116:Ubr4 APN 4 139479581 splice site probably benign
IGL03212:Ubr4 APN 4 139409763 missense probably benign 0.13
IGL03228:Ubr4 APN 4 139429598 missense probably damaging 1.00
IGL03292:Ubr4 APN 4 139440435 missense probably damaging 1.00
IGL03388:Ubr4 APN 4 139415032 missense probably damaging 0.98
IGL03393:Ubr4 APN 4 139452678 missense probably damaging 1.00
IGL03409:Ubr4 APN 4 139399929 nonsense probably null
Aqua_regia UTSW 4 139452719 nonsense probably null
Hardened UTSW 4 139468847 missense probably damaging 1.00
stoney UTSW 4 139444687 missense probably damaging 1.00
BB001:Ubr4 UTSW 4 139467276 missense unknown
BB011:Ubr4 UTSW 4 139467276 missense unknown
P0019:Ubr4 UTSW 4 139451781 missense probably damaging 1.00
PIT4544001:Ubr4 UTSW 4 139402560 missense possibly damaging 0.93
R0001:Ubr4 UTSW 4 139451788 missense probably damaging 1.00
R0002:Ubr4 UTSW 4 139390900 missense probably damaging 1.00
R0006:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0006:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0008:Ubr4 UTSW 4 139430176 missense probably damaging 1.00
R0027:Ubr4 UTSW 4 139400393 missense probably damaging 0.99
R0027:Ubr4 UTSW 4 139400393 missense probably damaging 0.99
R0030:Ubr4 UTSW 4 139426793 missense probably damaging 1.00
R0044:Ubr4 UTSW 4 139437058 splice site probably benign
R0044:Ubr4 UTSW 4 139437058 splice site probably benign
R0088:Ubr4 UTSW 4 139440814 missense probably damaging 1.00
R0131:Ubr4 UTSW 4 139464051 missense possibly damaging 0.66
R0184:Ubr4 UTSW 4 139445262 missense probably damaging 1.00
R0219:Ubr4 UTSW 4 139430257 missense possibly damaging 0.64
R0227:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0270:Ubr4 UTSW 4 139479435 splice site probably benign
R0285:Ubr4 UTSW 4 139440801 missense probably damaging 1.00
R0322:Ubr4 UTSW 4 139422418 missense probably damaging 1.00
R0363:Ubr4 UTSW 4 139391860 missense probably damaging 0.98
R0393:Ubr4 UTSW 4 139410860 splice site probably benign
R0450:Ubr4 UTSW 4 139430223 missense probably benign 0.14
R0504:Ubr4 UTSW 4 139406578 missense probably damaging 1.00
R0504:Ubr4 UTSW 4 139480838 critical splice donor site probably null
R0510:Ubr4 UTSW 4 139430223 missense probably benign 0.14
R0513:Ubr4 UTSW 4 139416875 missense possibly damaging 0.74
R0517:Ubr4 UTSW 4 139392124 missense probably benign 0.00
R0558:Ubr4 UTSW 4 139426902 missense probably benign 0.09
R0617:Ubr4 UTSW 4 139479062 critical splice donor site probably null
R0636:Ubr4 UTSW 4 139436302 splice site probably null
R0637:Ubr4 UTSW 4 139399615 missense probably damaging 1.00
R0652:Ubr4 UTSW 4 139401326 missense probably damaging 0.99
R0691:Ubr4 UTSW 4 139423906 missense probably damaging 1.00
R0729:Ubr4 UTSW 4 139485320 missense possibly damaging 0.66
R0735:Ubr4 UTSW 4 139428028 splice site probably null
R0751:Ubr4 UTSW 4 139437198 splice site probably benign
R0789:Ubr4 UTSW 4 139410271 critical splice donor site probably null
R0825:Ubr4 UTSW 4 139479576 critical splice donor site probably null
R0828:Ubr4 UTSW 4 139450553 splice site probably benign
R1052:Ubr4 UTSW 4 139455460 missense possibly damaging 0.83
R1184:Ubr4 UTSW 4 139437198 splice site probably benign
R1222:Ubr4 UTSW 4 139388471 splice site probably null
R1258:Ubr4 UTSW 4 139426914 missense probably damaging 1.00
R1321:Ubr4 UTSW 4 139460123 missense possibly damaging 0.46
R1385:Ubr4 UTSW 4 139402612 missense probably benign 0.00
R1450:Ubr4 UTSW 4 139468028 missense probably damaging 1.00
R1470:Ubr4 UTSW 4 139421226 splice site probably null
R1470:Ubr4 UTSW 4 139421226 splice site probably null
R1474:Ubr4 UTSW 4 139429579 missense probably damaging 1.00
R1479:Ubr4 UTSW 4 139425840 missense possibly damaging 0.95
R1534:Ubr4 UTSW 4 139428151 missense possibly damaging 0.95
R1546:Ubr4 UTSW 4 139416927 nonsense probably null
R1785:Ubr4 UTSW 4 139423945 missense probably damaging 1.00
R1786:Ubr4 UTSW 4 139423945 missense probably damaging 1.00
R1789:Ubr4 UTSW 4 139393053 missense probably damaging 1.00
R1796:Ubr4 UTSW 4 139428596 missense probably benign 0.25
R1800:Ubr4 UTSW 4 139407963 missense probably damaging 0.99
R1801:Ubr4 UTSW 4 139452563 splice site probably null
R1827:Ubr4 UTSW 4 139425697 critical splice acceptor site probably null
R1887:Ubr4 UTSW 4 139455560 missense probably damaging 1.00
R1966:Ubr4 UTSW 4 139451244 critical splice acceptor site probably null
R2010:Ubr4 UTSW 4 139480652 missense possibly damaging 0.92
R2049:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2069:Ubr4 UTSW 4 139479540 missense possibly damaging 0.66
R2114:Ubr4 UTSW 4 139429611 nonsense probably null
R2140:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2141:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2142:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2168:Ubr4 UTSW 4 139410649 missense probably benign 0.25
R2237:Ubr4 UTSW 4 139442790 missense probably damaging 1.00
R2249:Ubr4 UTSW 4 139448921 missense probably damaging 1.00
R2261:Ubr4 UTSW 4 139413462 missense probably damaging 0.99
R2264:Ubr4 UTSW 4 139420373 splice site probably benign
R2353:Ubr4 UTSW 4 139433673 missense possibly damaging 0.48
R2437:Ubr4 UTSW 4 139473542 missense possibly damaging 0.90
R2496:Ubr4 UTSW 4 139473205 unclassified probably benign
R2896:Ubr4 UTSW 4 139455644 splice site probably null
R2922:Ubr4 UTSW 4 139479500 missense possibly damaging 0.66
R2972:Ubr4 UTSW 4 139406536 missense probably benign 0.22
R2973:Ubr4 UTSW 4 139406536 missense probably benign 0.22
R2989:Ubr4 UTSW 4 139463558 missense possibly damaging 0.89
R3176:Ubr4 UTSW 4 139421855 missense probably benign 0.03
R3276:Ubr4 UTSW 4 139421855 missense probably benign 0.03
R3772:Ubr4 UTSW 4 139452700 missense possibly damaging 0.89
R3844:Ubr4 UTSW 4 139459126 missense probably damaging 0.99
R3873:Ubr4 UTSW 4 139423990 missense probably damaging 1.00
R3900:Ubr4 UTSW 4 139479062 critical splice donor site probably null
R3951:Ubr4 UTSW 4 139393094 missense probably damaging 1.00
R4020:Ubr4 UTSW 4 139451805 missense probably damaging 0.98
R4178:Ubr4 UTSW 4 139393414 missense probably damaging 1.00
R4308:Ubr4 UTSW 4 139472509 missense possibly damaging 0.46
R4378:Ubr4 UTSW 4 139410440 missense possibly damaging 0.76
R4400:Ubr4 UTSW 4 139461856 missense possibly damaging 0.66
R4421:Ubr4 UTSW 4 139461856 missense possibly damaging 0.66
R4462:Ubr4 UTSW 4 139418502 missense possibly damaging 0.47
R4583:Ubr4 UTSW 4 139380853 missense possibly damaging 0.82
R4611:Ubr4 UTSW 4 139399579 missense possibly damaging 0.93
R4664:Ubr4 UTSW 4 139406518 missense possibly damaging 0.56
R4671:Ubr4 UTSW 4 139436191 missense possibly damaging 0.66
R4672:Ubr4 UTSW 4 139410716 missense probably damaging 0.99
R4673:Ubr4 UTSW 4 139410716 missense probably damaging 0.99
R4696:Ubr4 UTSW 4 139408672 missense probably benign 0.09
R4701:Ubr4 UTSW 4 139471336 missense possibly damaging 0.66
R4726:Ubr4 UTSW 4 139482579 missense possibly damaging 0.46
R4728:Ubr4 UTSW 4 139423879 missense probably damaging 1.00
R4783:Ubr4 UTSW 4 139421733 missense possibly damaging 0.85
R4833:Ubr4 UTSW 4 139402546 missense probably damaging 0.98
R4892:Ubr4 UTSW 4 139428517 missense probably benign 0.14
R4936:Ubr4 UTSW 4 139396566 missense probably damaging 0.98
R5000:Ubr4 UTSW 4 139436169 missense probably damaging 0.98
R5114:Ubr4 UTSW 4 139410623 missense probably damaging 0.99
R5189:Ubr4 UTSW 4 139410649 missense probably benign 0.25
R5197:Ubr4 UTSW 4 139468097 missense probably damaging 1.00
R5213:Ubr4 UTSW 4 139402566 nonsense probably null
R5219:Ubr4 UTSW 4 139477232 nonsense probably null
R5346:Ubr4 UTSW 4 139428491 missense probably damaging 0.97
R5368:Ubr4 UTSW 4 139397528 intron probably benign
R5442:Ubr4 UTSW 4 139407772 missense probably damaging 1.00
R5527:Ubr4 UTSW 4 139480788 missense possibly damaging 0.83
R5548:Ubr4 UTSW 4 139460090 missense probably damaging 0.97
R5568:Ubr4 UTSW 4 139392038 missense probably damaging 0.99
R5639:Ubr4 UTSW 4 139452648 missense possibly damaging 0.66
R5643:Ubr4 UTSW 4 139444687 missense probably damaging 1.00
R5663:Ubr4 UTSW 4 139428583 missense possibly damaging 0.95
R5755:Ubr4 UTSW 4 139460095 missense possibly damaging 0.66
R5781:Ubr4 UTSW 4 139468096 missense probably damaging 1.00
R5784:Ubr4 UTSW 4 139425218 missense probably damaging 1.00
R5817:Ubr4 UTSW 4 139468847 missense probably damaging 1.00
R5872:Ubr4 UTSW 4 139425330 missense probably damaging 0.98
R5891:Ubr4 UTSW 4 139408626 nonsense probably null
R5901:Ubr4 UTSW 4 139451254 missense probably damaging 1.00
R5958:Ubr4 UTSW 4 139455638 missense probably damaging 1.00
R5974:Ubr4 UTSW 4 139421078 splice site probably null
R6065:Ubr4 UTSW 4 139421238 missense probably damaging 1.00
R6109:Ubr4 UTSW 4 139417364 missense probably damaging 0.99
R6207:Ubr4 UTSW 4 139421248 missense probably damaging 1.00
R6265:Ubr4 UTSW 4 139452640 missense possibly damaging 0.90
R6319:Ubr4 UTSW 4 139408889 missense possibly damaging 0.84
R6342:Ubr4 UTSW 4 139429539 missense possibly damaging 0.88
R6434:Ubr4 UTSW 4 139429638 missense probably damaging 1.00
R6437:Ubr4 UTSW 4 139397214 critical splice donor site probably null
R6481:Ubr4 UTSW 4 139431751 missense probably damaging 0.97
R6502:Ubr4 UTSW 4 139444671 missense probably damaging 1.00
R6546:Ubr4 UTSW 4 139414394 missense probably damaging 0.99
R6603:Ubr4 UTSW 4 139455586 missense probably benign 0.17
R6648:Ubr4 UTSW 4 139452719 nonsense probably null
R6649:Ubr4 UTSW 4 139473624 missense possibly damaging 0.66
R6653:Ubr4 UTSW 4 139473624 missense possibly damaging 0.66
R6668:Ubr4 UTSW 4 139465341 missense probably damaging 1.00
R6770:Ubr4 UTSW 4 139489182 missense unknown
R6772:Ubr4 UTSW 4 139467230 nonsense probably null
R6857:Ubr4 UTSW 4 139486051 missense possibly damaging 0.90
R6869:Ubr4 UTSW 4 139467227 missense possibly damaging 0.93
R6912:Ubr4 UTSW 4 139458234 critical splice donor site probably null
R6943:Ubr4 UTSW 4 139437131 nonsense probably null
R6970:Ubr4 UTSW 4 139406528 nonsense probably null
R6976:Ubr4 UTSW 4 139393077 missense probably damaging 0.98
R7000:Ubr4 UTSW 4 139414404 missense probably damaging 1.00
R7017:Ubr4 UTSW 4 139393090 missense probably damaging 0.99
R7165:Ubr4 UTSW 4 139450513 missense
R7222:Ubr4 UTSW 4 139463373 missense unknown
R7241:Ubr4 UTSW 4 139443414 missense probably damaging 1.00
R7343:Ubr4 UTSW 4 139413438 missense probably benign 0.09
R7367:Ubr4 UTSW 4 139452691 missense unknown
R7393:Ubr4 UTSW 4 139426785 missense probably damaging 1.00
R7432:Ubr4 UTSW 4 139388382 missense probably damaging 1.00
R7448:Ubr4 UTSW 4 139462467 missense unknown
R7502:Ubr4 UTSW 4 139412672 missense possibly damaging 0.72
R7514:Ubr4 UTSW 4 139452655 missense unknown
R7526:Ubr4 UTSW 4 139422417 missense probably benign 0.00
R7529:Ubr4 UTSW 4 139422417 missense probably benign 0.00
R7666:Ubr4 UTSW 4 139413480 missense possibly damaging 0.81
R7699:Ubr4 UTSW 4 139408867 nonsense probably null
R7700:Ubr4 UTSW 4 139408867 nonsense probably null
R7726:Ubr4 UTSW 4 139458920 missense unknown
R7753:Ubr4 UTSW 4 139470292 missense unknown
R7810:Ubr4 UTSW 4 139415083 missense
R7837:Ubr4 UTSW 4 139393151 nonsense probably null
R7868:Ubr4 UTSW 4 139460033 missense unknown
R7872:Ubr4 UTSW 4 139393062 missense possibly damaging 0.94
R7887:Ubr4 UTSW 4 139407810 missense probably damaging 0.99
R7924:Ubr4 UTSW 4 139467276 missense unknown
R7980:Ubr4 UTSW 4 139418406 missense
R7982:Ubr4 UTSW 4 139428208 critical splice donor site probably null
R8005:Ubr4 UTSW 4 139412630 missense probably damaging 0.98
R8054:Ubr4 UTSW 4 139468102 missense unknown
R8094:Ubr4 UTSW 4 139440696 missense probably damaging 0.97
R8151:Ubr4 UTSW 4 139402801 missense probably damaging 0.97
R8183:Ubr4 UTSW 4 139482471 missense unknown
R8252:Ubr4 UTSW 4 139473217 missense unknown
R8505:Ubr4 UTSW 4 139429569 missense
T0975:Ubr4 UTSW 4 139451781 missense probably damaging 1.00
X0028:Ubr4 UTSW 4 139410271 critical splice donor site probably null
Z1176:Ubr4 UTSW 4 139400385 missense probably damaging 1.00
Z1176:Ubr4 UTSW 4 139402660 missense probably benign 0.04
Z1176:Ubr4 UTSW 4 139410145 missense probably damaging 1.00
Z1177:Ubr4 UTSW 4 139450481 missense
Predicted Primers PCR Primer
(F):5'- AATGATCCAGCAGACCCCTTTTG -3'
(R):5'- ACTTCACAGGTAAGGAGCCC -3'

Sequencing Primer
(F):5'- TGTCCGCCGACAAGTTC -3'
(R):5'- TTCACAGGTAAGGAGCCCTAAATTC -3'
Posted On2015-10-21