Mutagenetix > Incidental Mutation

Incidental Mutation 'R4705:Plxnd1'

355109

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

b2b553Clo, 6230425C21Rik, b2b1863Clo

MMRRC Submission

041953-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4705 (G1)

Quality Score

193

Status

Validated

Chromosome

Chromosomal Location

115954811-115995005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 115958620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 1735 (L1735R)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

AlphaFold

Q3UH93

Predicted Effect

probably damaging
Transcript: ENSMUST00000015511
AA Change: L1735R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: L1735R

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123165

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203628

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205003

Meta Mutation Damage Score

0.6406

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

96% (113/118)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	T	C	9: 94,520,635	N325D	possibly damaging	Het
1700056E22Rik	A	G	1: 184,033,172	V230A	possibly damaging	Het
2010315B03Rik	T	C	9: 124,294,001	T123A	possibly damaging	Het
4932438A13Rik	C	T	3: 37,041,889	T1108I	probably benign	Het
Abca4	T	C	3: 122,105,370	V667A	probably damaging	Het
Abcb5	A	G	12: 118,965,305	S4P	possibly damaging	Het
Adam25	G	T	8: 40,754,126	C143F	probably damaging	Het
Ahnak	C	A	19: 9,016,906	H5185N	probably benign	Het
Apobec4	A	G	1: 152,756,250	T10A	probably benign	Het
Ascc1	A	G	10: 60,049,802	Y225C	probably damaging	Het
Aspscr1	A	T	11: 120,688,945	K39N	possibly damaging	Het
Atf7ip	C	T	6: 136,561,194	P483L	probably damaging	Het
Atp11a	C	G	8: 12,813,118	P99R	probably damaging	Het
B4galnt1	G	T	10: 127,167,525	V172F	possibly damaging	Het
Bag6	C	A	17: 35,142,343	P476H	probably damaging	Het
BC049730	T	A	7: 24,713,509	L114Q	probably damaging	Het
C2cd3	A	G	7: 100,395,188	K326E	possibly damaging	Het
Casp1	A	G	9: 5,306,204	D363G	probably damaging	Het
Ccdc33	G	T	9: 58,117,557	Q129K	probably benign	Het
Ccdc88a	T	C	11: 29,422,586	I107T	probably benign	Het
Cela2a	T	C	4: 141,821,411	N138S	probably benign	Het
Cfap61	A	C	2: 146,035,202	R460S	probably damaging	Het
Clstn2	T	C	9: 97,463,559	N579D	possibly damaging	Het
Col13a1	C	A	10: 61,850,165	G683W	unknown	Het
Col4a2	G	A	8: 11,313,504	R14Q	possibly damaging	Het
Cpa6	A	G	1: 10,481,058	S164P	probably benign	Het
Cpq	A	G	15: 33,497,338	N408S	probably benign	Het
Ctnnal1	T	C	4: 56,812,579	T690A	probably benign	Het
Cx3cl1	A	T	8: 94,780,207	N280I	probably benign	Het
Cyp2b19	C	T	7: 26,757,292	R36C	probably benign	Het
Ddx51	T	C	5: 110,655,308	V269A	probably damaging	Het
Dlst	G	T	12: 85,118,842		probably null	Het
Dmkn	G	C	7: 30,763,981	A20P	probably damaging	Het
Dnhd1	T	C	7: 105,655,741	I330T	probably damaging	Het
Dock3	G	A	9: 107,025,336	H292Y	probably damaging	Het
Ell	A	G	8: 70,578,934	D94G	possibly damaging	Het
Enam	T	A	5: 88,503,791	L1053*	probably null	Het
Fcgbp	A	G	7: 28,107,296	K2230E	probably benign	Het
Frmd5	G	T	2: 121,562,863		probably benign	Het
Gas2l1	G	A	11: 5,060,867	S654L	possibly damaging	Het
Gltpd2	G	T	11: 70,520,140	E86*	probably null	Het
Glyat	T	C	19: 12,651,297	L152P	possibly damaging	Het
Gm17330	T	C	12: 23,968,782	T22A	probably damaging	Het
Gm9931	T	A	1: 147,281,853		noncoding transcript	Het
Gpatch1	A	T	7: 35,299,305		probably null	Het
Gpr4	T	C	7: 19,222,894	L247P	probably damaging	Het
Gtpbp3	G	A	8: 71,491,114	E214K	probably benign	Het
Hdac7	G	T	15: 97,811,587	Q21K	probably damaging	Het
Hivep3	A	G	4: 119,872,050		probably benign	Het
Hk2	C	T	6: 82,739,650	M300I	possibly damaging	Het
Ighv1-61	T	C	12: 115,359,279	Y71C	probably damaging	Het
Il1f8	T	C	2: 24,154,618	V10A	probably benign	Het
Inpp5f	G	T	7: 128,663,987	S152I	probably damaging	Het
Jag1	C	A	2: 137,096,309	W257L	probably damaging	Het
Jak2	T	A	19: 29,294,915	N612K	possibly damaging	Het
Kalrn	T	C	16: 34,203,957	D610G	probably damaging	Het
Kbtbd6	A	G	14: 79,452,606	D247G	probably benign	Het
Kif15	A	G	9: 122,959,993		probably null	Het
Kndc1	A	G	7: 139,930,123	T1293A	possibly damaging	Het
Lpar5	T	C	6: 125,082,207	I297T	possibly damaging	Het
Lpin2	T	A	17: 71,232,143		probably benign	Het
Mfsd4a	A	T	1: 132,053,571	L230Q	probably damaging	Het
Mmp8	T	C	9: 7,565,549	V313A	probably benign	Het
Mrpl19	A	T	6: 81,964,285	D98E	probably damaging	Het
Mybl1	A	G	1: 9,690,115	I86T	probably damaging	Het
Nadk	C	A	4: 155,585,227	P157T	probably benign	Het
Necab1	T	C	4: 15,052,628	T117A	probably damaging	Het
Nol11	A	G	11: 107,184,718		probably benign	Het
Nucb2	G	A	7: 116,540,027		probably null	Het
Nupl1	G	T	14: 60,251,215	P19T	unknown	Het
Odf2	T	A	2: 29,904,034	L301Q	probably damaging	Het
Oit1	T	C	14: 8,349,347	E201G	probably benign	Het
Olfr374	T	A	8: 72,110,200	F211L	probably damaging	Het
Olfr736	A	G	14: 50,392,800	I15V	probably benign	Het
Oog4	T	C	4: 143,438,875	Y234C	probably benign	Het
Papln	T	C	12: 83,777,208		probably null	Het
Paqr6	C	T	3: 88,365,929	A76V	probably benign	Het
Pclo	A	G	5: 14,676,480		probably benign	Het
Pdzd8	T	C	19: 59,345,311	T93A	possibly damaging	Het
Pkdrej	A	T	15: 85,821,167	Y189*	probably null	Het
Pknox2	A	T	9: 36,923,638	N178K	possibly damaging	Het
Pla2g15	T	A	8: 106,163,059	M321K	probably benign	Het
Polm	T	A	11: 5,837,663	D30V	possibly damaging	Het
Rap1gap2	T	A	11: 74,437,439	I100F	probably damaging	Het
Rasgef1c	T	A	11: 49,978,467	W414R	probably benign	Het
Rassf1	A	G	9: 107,557,867	D187G	probably benign	Het
Rhag	T	C	17: 40,836,438	I397T	probably benign	Het
Rnft2	A	G	5: 118,228,863	F269S	probably damaging	Het
Rnmt	T	C	18: 68,314,125	F360S	probably damaging	Het
Ror2	C	T	13: 53,117,297	A329T	probably benign	Het
Slc4a1	T	A	11: 102,356,258	N501I	possibly damaging	Het
Slc4a7	T	A	14: 14,733,856	S89T	probably damaging	Het
Sptbn1	G	A	11: 30,100,660	H2310Y	probably benign	Het
Tbc1d9b	C	A	11: 50,140,462	N103K	probably benign	Het
Tbxas1	T	C	6: 39,083,857		probably null	Het
Tmem100	C	T	11: 90,035,563	T72I	probably damaging	Het
Ttc38	A	G	15: 85,852,963	T350A	probably benign	Het
Ubr4	C	T	4: 139,450,529	T3241M	probably damaging	Het
Unc13d	A	T	11: 116,073,388	M350K	possibly damaging	Het
Vit	T	C	17: 78,625,114	I550T	probably damaging	Het
Vmn1r31	C	A	6: 58,471,968	*304L	probably null	Het
Zbtb12	T	A	17: 34,896,401	H387Q	possibly damaging	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115967972	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115969945	missense	probably benign
IGL01323:Plxnd1	APN	6	115966799	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115960527	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115959935	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115978257	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115993628	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115963913	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115955742	makesense	probably null
IGL02873:Plxnd1	APN	6	115959976	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115962357	missense	probably damaging	1.00
Hiss	UTSW	6	115969929	missense	possibly damaging	0.94
murmer	UTSW	6	115968793	missense	probably benign	0.00
mutter	UTSW	6	115968044	missense	probably benign	0.27
rattle	UTSW	6	115959794	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115969460	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115958699	splice site	probably benign
R0648:Plxnd1	UTSW	6	115994001	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115966638	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115967005	splice site	probably null
R1292:Plxnd1	UTSW	6	115962683	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115968681	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115967779	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115994057	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115980601	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115966546	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115963914	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115969441	splice site	probably null
R1865:Plxnd1	UTSW	6	115969441	splice site	probably null
R1875:Plxnd1	UTSW	6	115978084	splice site	probably null
R1899:Plxnd1	UTSW	6	115969363	missense	probably benign
R1913:Plxnd1	UTSW	6	115978017	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115962517	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115967255	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115957548	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115962764	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115964144	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115962743	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115967748	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115959315	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115965953	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115956094	splice site	probably benign
R4280:Plxnd1	UTSW	6	115956095	splice site	probably null
R4346:Plxnd1	UTSW	6	115977980	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115993976	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115955756	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115968044	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115994276	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115972525	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115958615	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115960855	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115955765	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115994376	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115965901	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115958988	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115957648	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115965877	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115968688	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115967787	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115978174	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115977960	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115978492	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115976736	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115969929	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115993763	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115972507	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115960837	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115976639	missense	probably benign
R7699:Plxnd1	UTSW	6	115959794	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115966918	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115956617	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115972472	missense	probably benign
R8507:Plxnd1	UTSW	6	115966905	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115962807	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115957597	missense	probably damaging	1.00
R8963:Plxnd1	UTSW	6	115972545	nonsense	probably null
R9119:Plxnd1	UTSW	6	115955871	splice site	probably benign
R9177:Plxnd1	UTSW	6	115966508	missense	probably benign	0.00
R9182:Plxnd1	UTSW	6	115993785	missense	probably damaging	0.98
R9185:Plxnd1	UTSW	6	115957565	missense	probably damaging	1.00
R9226:Plxnd1	UTSW	6	115957563	missense	probably damaging	1.00
R9433:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R9449:Plxnd1	UTSW	6	115955769	missense	probably damaging	1.00
R9451:Plxnd1	UTSW	6	115963316	missense	possibly damaging	0.72
R9599:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9627:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9644:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9672:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
X0024:Plxnd1	UTSW	6	115963310	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115966784	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115967510	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ATGCCATGATACCATTGGTGCTC -3'
(R):5'- GTGGCCTCAAGTCACAAGAC -3'

Sequencing Primer
(F):5'- ATGATACCATTGGTGCTCTAACC -3'
(R):5'- AGAGGCCACATTCTGAGCC -3'

Posted On

2015-10-21