Mutagenetix > Incidental Mutations

Incidental Mutation 'R4705:Atf7ip'

355111

Institutional Source

Beutler Lab

Gene Symbol

Atf7ip

Ensembl Gene

ENSMUSG00000030213

Gene Name

activating transcription factor 7 interacting protein

Synonyms

Mcaf1, 2610204M12Rik, AM, ATFa-associated Modulator

MMRRC Submission

041953-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.913) question?

Stock #

R4705 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136506167-136610862 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 136561194 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 483 (P483L)

Ref Sequence

ENSEMBL: ENSMUSP00000140502 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032335] [ENSMUST00000185724] [ENSMUST00000186577] [ENSMUST00000186742] [ENSMUST00000187429] [ENSMUST00000189535] [ENSMUST00000203988]

AlphaFold

Q7TT18

Predicted Effect

probably damaging
Transcript: ENSMUST00000032335
AA Change: P475L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032335
Gene: ENSMUSG00000030213
AA Change: P475L

Domain	Start	End	E-Value	Type
internal_repeat_1	123	144	9.59e-5	PROSPERO
internal_repeat_1	143	164	9.59e-5	PROSPERO
low complexity region	184	212	N/A	INTRINSIC
low complexity region	246	262	N/A	INTRINSIC
low complexity region	284	303	N/A	INTRINSIC
low complexity region	409	427	N/A	INTRINSIC
low complexity region	567	582	N/A	INTRINSIC
Pfam:ATF7IP_BD	598	813	5.5e-62	PFAM
low complexity region	864	889	N/A	INTRINSIC
PDB:2RPQ\|B	974	1017	5e-7	PDB
low complexity region	1022	1036	N/A	INTRINSIC
low complexity region	1038	1050	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC
low complexity region	1168	1192	N/A	INTRINSIC
FN3	1194	1288	3.4e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000185724
AA Change: P475L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000140458
Gene: ENSMUSG00000030213
AA Change: P475L

Domain	Start	End	E-Value	Type
low complexity region	184	212	N/A	INTRINSIC
low complexity region	246	262	N/A	INTRINSIC
low complexity region	284	303	N/A	INTRINSIC
low complexity region	409	427	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186577

SMART Domains

Protein: ENSMUSP00000140121
Gene: ENSMUSG00000030213

Domain	Start	End	E-Value	Type
coiled coil region	71	101	N/A	INTRINSIC
low complexity region	106	116	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186742

Predicted Effect

probably damaging
Transcript: ENSMUST00000187429
AA Change: P483L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140502
Gene: ENSMUSG00000030213
AA Change: P483L

Domain	Start	End	E-Value	Type
internal_repeat_1	123	144	8.96e-5	PROSPERO
internal_repeat_1	143	164	8.96e-5	PROSPERO
low complexity region	184	212	N/A	INTRINSIC
low complexity region	246	262	N/A	INTRINSIC
low complexity region	284	303	N/A	INTRINSIC
low complexity region	409	427	N/A	INTRINSIC
low complexity region	567	582	N/A	INTRINSIC
coiled coil region	666	696	N/A	INTRINSIC
low complexity region	701	711	N/A	INTRINSIC
low complexity region	753	768	N/A	INTRINSIC
low complexity region	774	803	N/A	INTRINSIC
low complexity region	864	889	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000189535

Predicted Effect

unknown
Transcript: ENSMUST00000203178
AA Change: P117L

Predicted Effect

probably benign
Transcript: ENSMUST00000203988

SMART Domains

Protein: ENSMUSP00000145022
Gene: ENSMUSG00000030213

Domain	Start	End	E-Value	Type
Pfam:ATF7IP_BD	3	73	1.6e-26	PFAM

Meta Mutation Damage Score

0.3677

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

96% (113/118)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATF7IP is a multifunctional nuclear protein that associates with heterochromatin. It can act as a transcriptional coactivator or corepressor depending upon its binding partners (summary by Liu et al., 2009 [PubMed 19106100]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	T	C	9: 94,520,635	N325D	possibly damaging	Het
1700056E22Rik	A	G	1: 184,033,172	V230A	possibly damaging	Het
2010315B03Rik	T	C	9: 124,294,001	T123A	possibly damaging	Het
4932438A13Rik	C	T	3: 37,041,889	T1108I	probably benign	Het
Abca4	T	C	3: 122,105,370	V667A	probably damaging	Het
Abcb5	A	G	12: 118,965,305	S4P	possibly damaging	Het
Adam25	G	T	8: 40,754,126	C143F	probably damaging	Het
Ahnak	C	A	19: 9,016,906	H5185N	probably benign	Het
Apobec4	A	G	1: 152,756,250	T10A	probably benign	Het
Ascc1	A	G	10: 60,049,802	Y225C	probably damaging	Het
Aspscr1	A	T	11: 120,688,945	K39N	possibly damaging	Het
Atp11a	C	G	8: 12,813,118	P99R	probably damaging	Het
B4galnt1	G	T	10: 127,167,525	V172F	possibly damaging	Het
Bag6	C	A	17: 35,142,343	P476H	probably damaging	Het
BC049730	T	A	7: 24,713,509	L114Q	probably damaging	Het
C2cd3	A	G	7: 100,395,188	K326E	possibly damaging	Het
Casp1	A	G	9: 5,306,204	D363G	probably damaging	Het
Ccdc33	G	T	9: 58,117,557	Q129K	probably benign	Het
Ccdc88a	T	C	11: 29,422,586	I107T	probably benign	Het
Cela2a	T	C	4: 141,821,411	N138S	probably benign	Het
Cfap61	A	C	2: 146,035,202	R460S	probably damaging	Het
Clstn2	T	C	9: 97,463,559	N579D	possibly damaging	Het
Col13a1	C	A	10: 61,850,165	G683W	unknown	Het
Col4a2	G	A	8: 11,313,504	R14Q	possibly damaging	Het
Cpa6	A	G	1: 10,481,058	S164P	probably benign	Het
Cpq	A	G	15: 33,497,338	N408S	probably benign	Het
Ctnnal1	T	C	4: 56,812,579	T690A	probably benign	Het
Cx3cl1	A	T	8: 94,780,207	N280I	probably benign	Het
Cyp2b19	C	T	7: 26,757,292	R36C	probably benign	Het
Ddx51	T	C	5: 110,655,308	V269A	probably damaging	Het
Dlst	G	T	12: 85,118,842		probably null	Het
Dmkn	G	C	7: 30,763,981	A20P	probably damaging	Het
Dnhd1	T	C	7: 105,655,741	I330T	probably damaging	Het
Dock3	G	A	9: 107,025,336	H292Y	probably damaging	Het
Ell	A	G	8: 70,578,934	D94G	possibly damaging	Het
Enam	T	A	5: 88,503,791	L1053*	probably null	Het
Fcgbp	A	G	7: 28,107,296	K2230E	probably benign	Het
Frmd5	G	T	2: 121,562,863		probably benign	Het
Gas2l1	G	A	11: 5,060,867	S654L	possibly damaging	Het
Gltpd2	G	T	11: 70,520,140	E86*	probably null	Het
Glyat	T	C	19: 12,651,297	L152P	possibly damaging	Het
Gm17330	T	C	12: 23,968,782	T22A	probably damaging	Het
Gm9931	T	A	1: 147,281,853		noncoding transcript	Het
Gpatch1	A	T	7: 35,299,305		probably null	Het
Gpr4	T	C	7: 19,222,894	L247P	probably damaging	Het
Gtpbp3	G	A	8: 71,491,114	E214K	probably benign	Het
Hdac7	G	T	15: 97,811,587	Q21K	probably damaging	Het
Hivep3	A	G	4: 119,872,050		probably benign	Het
Hk2	C	T	6: 82,739,650	M300I	possibly damaging	Het
Ighv1-61	T	C	12: 115,359,279	Y71C	probably damaging	Het
Il1f8	T	C	2: 24,154,618	V10A	probably benign	Het
Inpp5f	G	T	7: 128,663,987	S152I	probably damaging	Het
Jag1	C	A	2: 137,096,309	W257L	probably damaging	Het
Jak2	T	A	19: 29,294,915	N612K	possibly damaging	Het
Kalrn	T	C	16: 34,203,957	D610G	probably damaging	Het
Kbtbd6	A	G	14: 79,452,606	D247G	probably benign	Het
Kif15	A	G	9: 122,959,993		probably null	Het
Kndc1	A	G	7: 139,930,123	T1293A	possibly damaging	Het
Lpar5	T	C	6: 125,082,207	I297T	possibly damaging	Het
Lpin2	T	A	17: 71,232,143		probably benign	Het
Mfsd4a	A	T	1: 132,053,571	L230Q	probably damaging	Het
Mmp8	T	C	9: 7,565,549	V313A	probably benign	Het
Mrpl19	A	T	6: 81,964,285	D98E	probably damaging	Het
Mybl1	A	G	1: 9,690,115	I86T	probably damaging	Het
Nadk	C	A	4: 155,585,227	P157T	probably benign	Het
Necab1	T	C	4: 15,052,628	T117A	probably damaging	Het
Nol11	A	G	11: 107,184,718		probably benign	Het
Nucb2	G	A	7: 116,540,027		probably null	Het
Nupl1	G	T	14: 60,251,215	P19T	unknown	Het
Odf2	T	A	2: 29,904,034	L301Q	probably damaging	Het
Oit1	T	C	14: 8,349,347	E201G	probably benign	Het
Olfr374	T	A	8: 72,110,200	F211L	probably damaging	Het
Olfr736	A	G	14: 50,392,800	I15V	probably benign	Het
Oog4	T	C	4: 143,438,875	Y234C	probably benign	Het
Papln	T	C	12: 83,777,208		probably null	Het
Paqr6	C	T	3: 88,365,929	A76V	probably benign	Het
Pclo	A	G	5: 14,676,480		probably benign	Het
Pdzd8	T	C	19: 59,345,311	T93A	possibly damaging	Het
Pkdrej	A	T	15: 85,821,167	Y189*	probably null	Het
Pknox2	A	T	9: 36,923,638	N178K	possibly damaging	Het
Pla2g15	T	A	8: 106,163,059	M321K	probably benign	Het
Plxnd1	A	C	6: 115,958,620	L1735R	probably damaging	Het
Polm	T	A	11: 5,837,663	D30V	possibly damaging	Het
Rap1gap2	T	A	11: 74,437,439	I100F	probably damaging	Het
Rasgef1c	T	A	11: 49,978,467	W414R	probably benign	Het
Rassf1	A	G	9: 107,557,867	D187G	probably benign	Het
Rhag	T	C	17: 40,836,438	I397T	probably benign	Het
Rnft2	A	G	5: 118,228,863	F269S	probably damaging	Het
Rnmt	T	C	18: 68,314,125	F360S	probably damaging	Het
Ror2	C	T	13: 53,117,297	A329T	probably benign	Het
Slc4a1	T	A	11: 102,356,258	N501I	possibly damaging	Het
Slc4a7	T	A	14: 14,733,856	S89T	probably damaging	Het
Sptbn1	G	A	11: 30,100,660	H2310Y	probably benign	Het
Tbc1d9b	C	A	11: 50,140,462	N103K	probably benign	Het
Tbxas1	T	C	6: 39,083,857		probably null	Het
Tmem100	C	T	11: 90,035,563	T72I	probably damaging	Het
Ttc38	A	G	15: 85,852,963	T350A	probably benign	Het
Ubr4	C	T	4: 139,450,529	T3241M	probably damaging	Het
Unc13d	A	T	11: 116,073,388	M350K	possibly damaging	Het
Vit	T	C	17: 78,625,114	I550T	probably damaging	Het
Vmn1r31	C	A	6: 58,471,968	*304L	probably null	Het
Zbtb12	T	A	17: 34,896,401	H387Q	possibly damaging	Het

Other mutations in Atf7ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Atf7ip	APN	6	136560681	missense	probably benign	0.00
IGL01483:Atf7ip	APN	6	136587459	missense	probably damaging	1.00
IGL02313:Atf7ip	APN	6	136606720	missense	probably damaging	0.99
IGL02319:Atf7ip	APN	6	136593118	missense	probably benign	0.01
IGL02547:Atf7ip	APN	6	136603276	splice site	probably benign
IGL02869:Atf7ip	APN	6	136606579	missense	probably damaging	0.99
IGL02895:Atf7ip	APN	6	136560688	missense	probably damaging	0.99
IGL02967:Atf7ip	APN	6	136606727	missense	probably damaging	0.98
IGL03026:Atf7ip	APN	6	136605382	missense	possibly damaging	0.79
R0045_atf7ip_757	UTSW	6	136559816	missense	probably damaging	1.00
R4618_atf7ip_091	UTSW	6	136565106	missense	probably damaging	1.00
R7365_Atf7ip_708	UTSW	6	136560710	missense	probably benign
R0024:Atf7ip	UTSW	6	136599820	splice site	probably benign
R0045:Atf7ip	UTSW	6	136559816	missense	probably damaging	1.00
R0045:Atf7ip	UTSW	6	136559816	missense	probably damaging	1.00
R0325:Atf7ip	UTSW	6	136560989	missense	possibly damaging	0.86
R0331:Atf7ip	UTSW	6	136561163	missense	possibly damaging	0.94
R0415:Atf7ip	UTSW	6	136560012	missense	possibly damaging	0.92
R0490:Atf7ip	UTSW	6	136609192	unclassified	probably benign
R0526:Atf7ip	UTSW	6	136559805	missense	probably damaging	1.00
R1503:Atf7ip	UTSW	6	136606867	missense	probably damaging	0.96
R1663:Atf7ip	UTSW	6	136603324	missense	possibly damaging	0.93
R1793:Atf7ip	UTSW	6	136609219	unclassified	probably benign
R1822:Atf7ip	UTSW	6	136587260	missense	probably benign	0.11
R1873:Atf7ip	UTSW	6	136559888	missense	probably damaging	1.00
R1937:Atf7ip	UTSW	6	136560780	missense	probably benign	0.41
R2059:Atf7ip	UTSW	6	136609348	unclassified	probably benign
R2134:Atf7ip	UTSW	6	136605487	missense	possibly damaging	0.80
R2679:Atf7ip	UTSW	6	136566651	missense	possibly damaging	0.62
R3430:Atf7ip	UTSW	6	136575324	unclassified	probably benign
R3755:Atf7ip	UTSW	6	136560817	missense	probably benign	0.01
R3756:Atf7ip	UTSW	6	136560817	missense	probably benign	0.01
R3890:Atf7ip	UTSW	6	136587045	missense	possibly damaging	0.48
R4190:Atf7ip	UTSW	6	136587501	missense	probably damaging	1.00
R4494:Atf7ip	UTSW	6	136563749	splice site	probably null
R4588:Atf7ip	UTSW	6	136599694	missense	probably benign
R4618:Atf7ip	UTSW	6	136565106	missense	probably damaging	1.00
R4838:Atf7ip	UTSW	6	136596491	missense	probably benign	0.06
R4922:Atf7ip	UTSW	6	136560041	missense	possibly damaging	0.91
R4956:Atf7ip	UTSW	6	136606810	missense	probably damaging	1.00
R4957:Atf7ip	UTSW	6	136606810	missense	probably damaging	1.00
R4958:Atf7ip	UTSW	6	136606810	missense	probably damaging	1.00
R5000:Atf7ip	UTSW	6	136582428	missense	probably damaging	1.00
R5001:Atf7ip	UTSW	6	136561388	missense	probably damaging	0.99
R5075:Atf7ip	UTSW	6	136560234	missense	probably benign
R5279:Atf7ip	UTSW	6	136603379	nonsense	probably null
R5445:Atf7ip	UTSW	6	136587257	missense	probably damaging	1.00
R5844:Atf7ip	UTSW	6	136606814	missense	probably damaging	1.00
R5850:Atf7ip	UTSW	6	136566787	critical splice donor site	probably null
R5891:Atf7ip	UTSW	6	136559977	missense	possibly damaging	0.64
R5987:Atf7ip	UTSW	6	136571502	missense	probably damaging	1.00
R6168:Atf7ip	UTSW	6	136559819	missense	probably damaging	1.00
R6726:Atf7ip	UTSW	6	136582391	missense	probably damaging	1.00
R6880:Atf7ip	UTSW	6	136561040	missense	probably damaging	1.00
R6924:Atf7ip	UTSW	6	136559757	splice site	probably null
R7075:Atf7ip	UTSW	6	136596515	critical splice donor site	probably null
R7308:Atf7ip	UTSW	6	136565089	missense	probably benign	0.01
R7365:Atf7ip	UTSW	6	136560710	missense	probably benign
R7556:Atf7ip	UTSW	6	136561241	missense	probably damaging	0.99
R7812:Atf7ip	UTSW	6	136603417	missense	probably damaging	0.96
R7973:Atf7ip	UTSW	6	136561064	nonsense	probably null
R8032:Atf7ip	UTSW	6	136565112	missense	probably benign	0.00
R8203:Atf7ip	UTSW	6	136606783	missense	probably damaging	0.99
R8274:Atf7ip	UTSW	6	136560990	missense	probably benign
R8784:Atf7ip	UTSW	6	136599650	missense	probably damaging	0.99
R8785:Atf7ip	UTSW	6	136587164	missense	probably damaging	0.97
R8885:Atf7ip	UTSW	6	136587143	missense	probably benign	0.06
R8957:Atf7ip	UTSW	6	136566703	missense	probably null	0.99
R9042:Atf7ip	UTSW	6	136561265	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAGATAGCGGAGGATCCCATC -3'
(R):5'- GGACTCATCTTTTCCACACGAAAG -3'

Sequencing Primer
(F):5'- ATCCCATCGCTGAGCCTG -3'
(R):5'- GAAAGATCCTCTTCATCAGAAAGG -3'

Posted On

2015-10-21