Mutagenetix > Incidental Mutation

Incidental Mutation 'R4705:C2cd3'

355117

Institutional Source

Beutler Lab

Gene Symbol

C2cd3

Ensembl Gene

ENSMUSG00000047248

Gene Name

C2 calcium-dependent domain containing 3

Synonyms

MMRRC Submission

041953-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4705 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100372233-100470152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100395188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 326 (K326E)

Ref Sequence

ENSEMBL: ENSMUSP00000062637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000133464]

AlphaFold

Q52KB6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051777
AA Change: K326E

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: K326E

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
low complexity region	2180	2197	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098259
AA Change: K326E

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: K326E

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119647

SMART Domains

Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
C2	61	199	2.36e1	SMART
C2	327	436	3.73e0	SMART
C2	526	666	1.47e1	SMART
C2	719	858	1.63e1	SMART
C2	1154	1261	1.43e-2	SMART
low complexity region	1429	1443	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133464

SMART Domains

Protein: ENSMUSP00000118864
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156559

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208753

Meta Mutation Damage Score

0.0626

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

96% (113/118)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	T	C	9: 94,520,635	N325D	possibly damaging	Het
1700056E22Rik	A	G	1: 184,033,172	V230A	possibly damaging	Het
2010315B03Rik	T	C	9: 124,294,001	T123A	possibly damaging	Het
4932438A13Rik	C	T	3: 37,041,889	T1108I	probably benign	Het
Abca4	T	C	3: 122,105,370	V667A	probably damaging	Het
Abcb5	A	G	12: 118,965,305	S4P	possibly damaging	Het
Adam25	G	T	8: 40,754,126	C143F	probably damaging	Het
Ahnak	C	A	19: 9,016,906	H5185N	probably benign	Het
Apobec4	A	G	1: 152,756,250	T10A	probably benign	Het
Ascc1	A	G	10: 60,049,802	Y225C	probably damaging	Het
Aspscr1	A	T	11: 120,688,945	K39N	possibly damaging	Het
Atf7ip	C	T	6: 136,561,194	P483L	probably damaging	Het
Atp11a	C	G	8: 12,813,118	P99R	probably damaging	Het
B4galnt1	G	T	10: 127,167,525	V172F	possibly damaging	Het
Bag6	C	A	17: 35,142,343	P476H	probably damaging	Het
BC049730	T	A	7: 24,713,509	L114Q	probably damaging	Het
Casp1	A	G	9: 5,306,204	D363G	probably damaging	Het
Ccdc33	G	T	9: 58,117,557	Q129K	probably benign	Het
Ccdc88a	T	C	11: 29,422,586	I107T	probably benign	Het
Cela2a	T	C	4: 141,821,411	N138S	probably benign	Het
Cfap61	A	C	2: 146,035,202	R460S	probably damaging	Het
Clstn2	T	C	9: 97,463,559	N579D	possibly damaging	Het
Col13a1	C	A	10: 61,850,165	G683W	unknown	Het
Col4a2	G	A	8: 11,313,504	R14Q	possibly damaging	Het
Cpa6	A	G	1: 10,481,058	S164P	probably benign	Het
Cpq	A	G	15: 33,497,338	N408S	probably benign	Het
Ctnnal1	T	C	4: 56,812,579	T690A	probably benign	Het
Cx3cl1	A	T	8: 94,780,207	N280I	probably benign	Het
Cyp2b19	C	T	7: 26,757,292	R36C	probably benign	Het
Ddx51	T	C	5: 110,655,308	V269A	probably damaging	Het
Dlst	G	T	12: 85,118,842		probably null	Het
Dmkn	G	C	7: 30,763,981	A20P	probably damaging	Het
Dnhd1	T	C	7: 105,655,741	I330T	probably damaging	Het
Dock3	G	A	9: 107,025,336	H292Y	probably damaging	Het
Ell	A	G	8: 70,578,934	D94G	possibly damaging	Het
Enam	T	A	5: 88,503,791	L1053*	probably null	Het
Fcgbp	A	G	7: 28,107,296	K2230E	probably benign	Het
Frmd5	G	T	2: 121,562,863		probably benign	Het
Gas2l1	G	A	11: 5,060,867	S654L	possibly damaging	Het
Gltpd2	G	T	11: 70,520,140	E86*	probably null	Het
Glyat	T	C	19: 12,651,297	L152P	possibly damaging	Het
Gm17330	T	C	12: 23,968,782	T22A	probably damaging	Het
Gm9931	T	A	1: 147,281,853		noncoding transcript	Het
Gpatch1	A	T	7: 35,299,305		probably null	Het
Gpr4	T	C	7: 19,222,894	L247P	probably damaging	Het
Gtpbp3	G	A	8: 71,491,114	E214K	probably benign	Het
Hdac7	G	T	15: 97,811,587	Q21K	probably damaging	Het
Hivep3	A	G	4: 119,872,050		probably benign	Het
Hk2	C	T	6: 82,739,650	M300I	possibly damaging	Het
Ighv1-61	T	C	12: 115,359,279	Y71C	probably damaging	Het
Il1f8	T	C	2: 24,154,618	V10A	probably benign	Het
Inpp5f	G	T	7: 128,663,987	S152I	probably damaging	Het
Jag1	C	A	2: 137,096,309	W257L	probably damaging	Het
Jak2	T	A	19: 29,294,915	N612K	possibly damaging	Het
Kalrn	T	C	16: 34,203,957	D610G	probably damaging	Het
Kbtbd6	A	G	14: 79,452,606	D247G	probably benign	Het
Kif15	A	G	9: 122,959,993		probably null	Het
Kndc1	A	G	7: 139,930,123	T1293A	possibly damaging	Het
Lpar5	T	C	6: 125,082,207	I297T	possibly damaging	Het
Lpin2	T	A	17: 71,232,143		probably benign	Het
Mfsd4a	A	T	1: 132,053,571	L230Q	probably damaging	Het
Mmp8	T	C	9: 7,565,549	V313A	probably benign	Het
Mrpl19	A	T	6: 81,964,285	D98E	probably damaging	Het
Mybl1	A	G	1: 9,690,115	I86T	probably damaging	Het
Nadk	C	A	4: 155,585,227	P157T	probably benign	Het
Necab1	T	C	4: 15,052,628	T117A	probably damaging	Het
Nol11	A	G	11: 107,184,718		probably benign	Het
Nucb2	G	A	7: 116,540,027		probably null	Het
Nupl1	G	T	14: 60,251,215	P19T	unknown	Het
Odf2	T	A	2: 29,904,034	L301Q	probably damaging	Het
Oit1	T	C	14: 8,349,347	E201G	probably benign	Het
Olfr374	T	A	8: 72,110,200	F211L	probably damaging	Het
Olfr736	A	G	14: 50,392,800	I15V	probably benign	Het
Oog4	T	C	4: 143,438,875	Y234C	probably benign	Het
Papln	T	C	12: 83,777,208		probably null	Het
Paqr6	C	T	3: 88,365,929	A76V	probably benign	Het
Pclo	A	G	5: 14,676,480		probably benign	Het
Pdzd8	T	C	19: 59,345,311	T93A	possibly damaging	Het
Pkdrej	A	T	15: 85,821,167	Y189*	probably null	Het
Pknox2	A	T	9: 36,923,638	N178K	possibly damaging	Het
Pla2g15	T	A	8: 106,163,059	M321K	probably benign	Het
Plxnd1	A	C	6: 115,958,620	L1735R	probably damaging	Het
Polm	T	A	11: 5,837,663	D30V	possibly damaging	Het
Rap1gap2	T	A	11: 74,437,439	I100F	probably damaging	Het
Rasgef1c	T	A	11: 49,978,467	W414R	probably benign	Het
Rassf1	A	G	9: 107,557,867	D187G	probably benign	Het
Rhag	T	C	17: 40,836,438	I397T	probably benign	Het
Rnft2	A	G	5: 118,228,863	F269S	probably damaging	Het
Rnmt	T	C	18: 68,314,125	F360S	probably damaging	Het
Ror2	C	T	13: 53,117,297	A329T	probably benign	Het
Slc4a1	T	A	11: 102,356,258	N501I	possibly damaging	Het
Slc4a7	T	A	14: 14,733,856	S89T	probably damaging	Het
Sptbn1	G	A	11: 30,100,660	H2310Y	probably benign	Het
Tbc1d9b	C	A	11: 50,140,462	N103K	probably benign	Het
Tbxas1	T	C	6: 39,083,857		probably null	Het
Tmem100	C	T	11: 90,035,563	T72I	probably damaging	Het
Ttc38	A	G	15: 85,852,963	T350A	probably benign	Het
Ubr4	C	T	4: 139,450,529	T3241M	probably damaging	Het
Unc13d	A	T	11: 116,073,388	M350K	possibly damaging	Het
Vit	T	C	17: 78,625,114	I550T	probably damaging	Het
Vmn1r31	C	A	6: 58,471,968	*304L	probably null	Het
Zbtb12	T	A	17: 34,896,401	H387Q	possibly damaging	Het

Other mutations in C2cd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:C2cd3	APN	7	100391128	missense	probably benign	0.14
IGL01420:C2cd3	APN	7	100454858	missense	probably benign	0.35
IGL01775:C2cd3	APN	7	100443431	missense	probably damaging	1.00
IGL01832:C2cd3	APN	7	100427214	missense	possibly damaging	0.94
IGL01883:C2cd3	APN	7	100374486	missense	possibly damaging	0.80
IGL02664:C2cd3	APN	7	100419715	missense	possibly damaging	0.67
IGL02697:C2cd3	APN	7	100427169	unclassified	probably benign
IGL02852:C2cd3	APN	7	100430189	missense	probably damaging	1.00
IGL03158:C2cd3	APN	7	100374476	missense	probably damaging	1.00
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0124:C2cd3	UTSW	7	100469518	missense	probably benign
R0387:C2cd3	UTSW	7	100422507	splice site	probably benign
R0522:C2cd3	UTSW	7	100395222	missense	probably benign	0.14
R1124:C2cd3	UTSW	7	100422681	missense	probably benign	0.00
R1484:C2cd3	UTSW	7	100440190	missense	probably damaging	1.00
R1533:C2cd3	UTSW	7	100406077	missense	possibly damaging	0.54
R1631:C2cd3	UTSW	7	100372497	critical splice donor site	probably null
R1875:C2cd3	UTSW	7	100407025	missense	possibly damaging	0.89
R2059:C2cd3	UTSW	7	100455493	unclassified	probably benign
R2060:C2cd3	UTSW	7	100454948	missense	probably damaging	1.00
R2348:C2cd3	UTSW	7	100413366	missense	probably damaging	1.00
R3103:C2cd3	UTSW	7	100395252	missense	possibly damaging	0.47
R3405:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R3687:C2cd3	UTSW	7	100435833	missense	probably benign	0.28
R3775:C2cd3	UTSW	7	100431998	missense	probably damaging	1.00
R3854:C2cd3	UTSW	7	100454601	critical splice acceptor site	probably null
R4359:C2cd3	UTSW	7	100441089	missense	probably damaging	1.00
R4403:C2cd3	UTSW	7	100432099	missense	probably damaging	1.00
R4446:C2cd3	UTSW	7	100374477	missense	probably damaging	1.00
R4646:C2cd3	UTSW	7	100372450	unclassified	probably benign
R4770:C2cd3	UTSW	7	100443435	missense	probably damaging	1.00
R4777:C2cd3	UTSW	7	100416332	missense	possibly damaging	0.46
R4816:C2cd3	UTSW	7	100391019	missense	probably benign	0.01
R4842:C2cd3	UTSW	7	100416190	missense	probably benign	0.00
R4858:C2cd3	UTSW	7	100454953	missense	probably damaging	1.00
R4871:C2cd3	UTSW	7	100413374	missense	possibly damaging	0.79
R4898:C2cd3	UTSW	7	100405959	missense	probably damaging	1.00
R5026:C2cd3	UTSW	7	100459842	missense	possibly damaging	0.52
R5112:C2cd3	UTSW	7	100443485	missense	possibly damaging	0.91
R5242:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R5538:C2cd3	UTSW	7	100455493	critical splice donor site	probably null
R5861:C2cd3	UTSW	7	100444475	unclassified	probably benign
R6110:C2cd3	UTSW	7	100441076	missense	probably damaging	1.00
R6326:C2cd3	UTSW	7	100416428	missense	probably benign	0.02
R6429:C2cd3	UTSW	7	100432091	missense	probably damaging	1.00
R6610:C2cd3	UTSW	7	100455298	missense	probably benign
R6613:C2cd3	UTSW	7	100395241	missense	possibly damaging	0.87
R6631:C2cd3	UTSW	7	100418540	missense	probably damaging	1.00
R6787:C2cd3	UTSW	7	100455346	missense	probably benign
R6837:C2cd3	UTSW	7	100448746	missense	probably damaging	1.00
R6849:C2cd3	UTSW	7	100406927	missense	probably damaging	1.00
R6860:C2cd3	UTSW	7	100390241	missense	probably benign	0.28
R6929:C2cd3	UTSW	7	100451619	missense	probably damaging	1.00
R7026:C2cd3	UTSW	7	100432092	missense	probably damaging	1.00
R7088:C2cd3	UTSW	7	100416181	missense
R7174:C2cd3	UTSW	7	100432198	missense
R7241:C2cd3	UTSW	7	100407050	missense
R7335:C2cd3	UTSW	7	100422603	missense
R7357:C2cd3	UTSW	7	100430103	missense
R7493:C2cd3	UTSW	7	100427226	missense
R7567:C2cd3	UTSW	7	100430815	missense
R7573:C2cd3	UTSW	7	100419707	missense
R7869:C2cd3	UTSW	7	100469491	missense	probably damaging	0.99
R7999:C2cd3	UTSW	7	100459889	critical splice donor site	probably null
R8134:C2cd3	UTSW	7	100418504	missense
R8369:C2cd3	UTSW	7	100395258	missense	probably benign	0.03
R8372:C2cd3	UTSW	7	100455280	nonsense	probably null
R8753:C2cd3	UTSW	7	100399817	critical splice donor site	probably null
R8893:C2cd3	UTSW	7	100454797	missense	probably benign
R8905:C2cd3	UTSW	7	100424925	critical splice donor site	probably null
R8945:C2cd3	UTSW	7	100391079	missense	possibly damaging	0.88
R8970:C2cd3	UTSW	7	100419764	missense
R9000:C2cd3	UTSW	7	100416074	missense
R9064:C2cd3	UTSW	7	100410401	missense
R9072:C2cd3	UTSW	7	100391084	missense	probably benign	0.07
R9126:C2cd3	UTSW	7	100432223	missense
R9160:C2cd3	UTSW	7	100426029	missense
R9234:C2cd3	UTSW	7	100399805	missense
R9258:C2cd3	UTSW	7	100448819	missense
R9295:C2cd3	UTSW	7	100432527	missense
R9411:C2cd3	UTSW	7	100416497	missense
R9420:C2cd3	UTSW	7	100416055	missense
R9589:C2cd3	UTSW	7	100432549	missense
R9628:C2cd3	UTSW	7	100448754	missense
R9629:C2cd3	UTSW	7	100380042	missense	probably damaging	1.00
R9681:C2cd3	UTSW	7	100374455	missense	probably benign	0.32
R9775:C2cd3	UTSW	7	100427251	missense
X0002:C2cd3	UTSW	7	100440235	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- TCAGTCTCTCTGGGAAAGGG -3'
(R):5'- AGGCAAGTCAACAGCTCAG -3'

Sequencing Primer
(F):5'- GCACACAGCGTTGTTAAGC -3'
(R):5'- CAGCTCAGGAAGTTAGCTGC -3'

Posted On

2015-10-21