Incidental Mutation 'R4705:Kndc1'
ID 355121
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
MMRRC Submission 041953-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4705 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139510036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1293 (T1293A)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect possibly damaging
Transcript: ENSMUST00000053445
AA Change: T1293A

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: T1293A

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156941
Meta Mutation Damage Score 0.0627 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 96% (113/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 183,765,369 (GRCm39) V230A possibly damaging Het
2010315B03Rik T C 9: 124,056,631 (GRCm39) T123A possibly damaging Het
Abca4 T C 3: 121,899,019 (GRCm39) V667A probably damaging Het
Abcb5 A G 12: 118,929,040 (GRCm39) S4P possibly damaging Het
Adam25 G T 8: 41,207,163 (GRCm39) C143F probably damaging Het
Ahnak C A 19: 8,994,270 (GRCm39) H5185N probably benign Het
Apobec4 A G 1: 152,632,001 (GRCm39) T10A probably benign Het
Ascc1 A G 10: 59,885,624 (GRCm39) Y225C probably damaging Het
Aspscr1 A T 11: 120,579,771 (GRCm39) K39N possibly damaging Het
Atf7ip C T 6: 136,538,192 (GRCm39) P483L probably damaging Het
Atp11a C G 8: 12,863,118 (GRCm39) P99R probably damaging Het
B4galnt1 G T 10: 127,003,394 (GRCm39) V172F possibly damaging Het
Bag6 C A 17: 35,361,319 (GRCm39) P476H probably damaging Het
Bltp1 C T 3: 37,096,038 (GRCm39) T1108I probably benign Het
C2cd3 A G 7: 100,044,395 (GRCm39) K326E possibly damaging Het
Casp1 A G 9: 5,306,204 (GRCm39) D363G probably damaging Het
Ccdc33 G T 9: 58,024,840 (GRCm39) Q129K probably benign Het
Ccdc88a T C 11: 29,372,586 (GRCm39) I107T probably benign Het
Cela2a T C 4: 141,548,722 (GRCm39) N138S probably benign Het
Cfap61 A C 2: 145,877,122 (GRCm39) R460S probably damaging Het
Clstn2 T C 9: 97,345,612 (GRCm39) N579D possibly damaging Het
Col13a1 C A 10: 61,685,944 (GRCm39) G683W unknown Het
Col4a2 G A 8: 11,363,504 (GRCm39) R14Q possibly damaging Het
Cpa6 A G 1: 10,551,283 (GRCm39) S164P probably benign Het
Cpq A G 15: 33,497,484 (GRCm39) N408S probably benign Het
Ctnnal1 T C 4: 56,812,579 (GRCm39) T690A probably benign Het
Cx3cl1 A T 8: 95,506,835 (GRCm39) N280I probably benign Het
Cyp2b19 C T 7: 26,456,717 (GRCm39) R36C probably benign Het
Ddx51 T C 5: 110,803,174 (GRCm39) V269A probably damaging Het
Dipk2a T C 9: 94,402,688 (GRCm39) N325D possibly damaging Het
Dlst G T 12: 85,165,616 (GRCm39) probably null Het
Dmkn G C 7: 30,463,406 (GRCm39) A20P probably damaging Het
Dnhd1 T C 7: 105,304,948 (GRCm39) I330T probably damaging Het
Dock3 G A 9: 106,902,535 (GRCm39) H292Y probably damaging Het
Ell A G 8: 71,031,584 (GRCm39) D94G possibly damaging Het
Enam T A 5: 88,651,650 (GRCm39) L1053* probably null Het
Fam3d T C 14: 8,349,347 (GRCm38) E201G probably benign Het
Fcgbp A G 7: 27,806,721 (GRCm39) K2230E probably benign Het
Frmd5 G T 2: 121,393,344 (GRCm39) probably benign Het
Gas2l1 G A 11: 5,010,867 (GRCm39) S654L possibly damaging Het
Gltpd2 G T 11: 70,410,966 (GRCm39) E86* probably null Het
Glyat T C 19: 12,628,661 (GRCm39) L152P possibly damaging Het
Gm17330 T C 12: 24,018,783 (GRCm39) T22A probably damaging Het
Gm9931 T A 1: 147,157,591 (GRCm39) noncoding transcript Het
Gpatch1 A T 7: 34,998,730 (GRCm39) probably null Het
Gpr4 T C 7: 18,956,819 (GRCm39) L247P probably damaging Het
Gtpbp3 G A 8: 71,943,758 (GRCm39) E214K probably benign Het
Hdac7 G T 15: 97,709,468 (GRCm39) Q21K probably damaging Het
Hivep3 A G 4: 119,729,247 (GRCm39) probably benign Het
Hk2 C T 6: 82,716,631 (GRCm39) M300I possibly damaging Het
Ighv1-61 T C 12: 115,322,899 (GRCm39) Y71C probably damaging Het
Il36b T C 2: 24,044,630 (GRCm39) V10A probably benign Het
Inpp5f G T 7: 128,265,711 (GRCm39) S152I probably damaging Het
Jag1 C A 2: 136,938,229 (GRCm39) W257L probably damaging Het
Jak2 T A 19: 29,272,315 (GRCm39) N612K possibly damaging Het
Kalrn T C 16: 34,024,327 (GRCm39) D610G probably damaging Het
Kbtbd6 A G 14: 79,690,046 (GRCm39) D247G probably benign Het
Kif15 A G 9: 122,789,058 (GRCm39) probably null Het
Lpar5 T C 6: 125,059,170 (GRCm39) I297T possibly damaging Het
Lpin2 T A 17: 71,539,138 (GRCm39) probably benign Het
Lypd10 T A 7: 24,412,934 (GRCm39) L114Q probably damaging Het
Mfsd4a A T 1: 131,981,309 (GRCm39) L230Q probably damaging Het
Mmp8 T C 9: 7,565,550 (GRCm39) V313A probably benign Het
Mrpl19 A T 6: 81,941,266 (GRCm39) D98E probably damaging Het
Mybl1 A G 1: 9,760,340 (GRCm39) I86T probably damaging Het
Nadk C A 4: 155,669,684 (GRCm39) P157T probably benign Het
Necab1 T C 4: 15,052,628 (GRCm39) T117A probably damaging Het
Nol11 A G 11: 107,075,544 (GRCm39) probably benign Het
Nucb2 G A 7: 116,139,262 (GRCm39) probably null Het
Nup58 G T 14: 60,488,664 (GRCm39) P19T unknown Het
Odf2 T A 2: 29,794,046 (GRCm39) L301Q probably damaging Het
Oog4 T C 4: 143,165,445 (GRCm39) Y234C probably benign Het
Or11j4 A G 14: 50,630,257 (GRCm39) I15V probably benign Het
Or1ab2 T A 8: 72,864,044 (GRCm39) F211L probably damaging Het
Papln T C 12: 83,823,982 (GRCm39) probably null Het
Paqr6 C T 3: 88,273,236 (GRCm39) A76V probably benign Het
Pclo A G 5: 14,726,494 (GRCm39) probably benign Het
Pdzd8 T C 19: 59,333,743 (GRCm39) T93A possibly damaging Het
Pkdrej A T 15: 85,705,368 (GRCm39) Y189* probably null Het
Pknox2 A T 9: 36,834,934 (GRCm39) N178K possibly damaging Het
Pla2g15 T A 8: 106,889,691 (GRCm39) M321K probably benign Het
Plxnd1 A C 6: 115,935,581 (GRCm39) L1735R probably damaging Het
Polm T A 11: 5,787,663 (GRCm39) D30V possibly damaging Het
Rap1gap2 T A 11: 74,328,265 (GRCm39) I100F probably damaging Het
Rasgef1c T A 11: 49,869,294 (GRCm39) W414R probably benign Het
Rassf1 A G 9: 107,435,066 (GRCm39) D187G probably benign Het
Rhag T C 17: 41,147,329 (GRCm39) I397T probably benign Het
Rnft2 A G 5: 118,366,928 (GRCm39) F269S probably damaging Het
Rnmt T C 18: 68,447,196 (GRCm39) F360S probably damaging Het
Ror2 C T 13: 53,271,333 (GRCm39) A329T probably benign Het
Slc4a1 T A 11: 102,247,084 (GRCm39) N501I possibly damaging Het
Slc4a7 T A 14: 14,733,856 (GRCm38) S89T probably damaging Het
Sptbn1 G A 11: 30,050,660 (GRCm39) H2310Y probably benign Het
Tbc1d9b C A 11: 50,031,289 (GRCm39) N103K probably benign Het
Tbxas1 T C 6: 39,060,791 (GRCm39) probably null Het
Tmem100 C T 11: 89,926,389 (GRCm39) T72I probably damaging Het
Ttc38 A G 15: 85,737,164 (GRCm39) T350A probably benign Het
Ubr4 C T 4: 139,177,840 (GRCm39) T3241M probably damaging Het
Unc13d A T 11: 115,964,214 (GRCm39) M350K possibly damaging Het
Vit T C 17: 78,932,543 (GRCm39) I550T probably damaging Het
Vmn1r31 C A 6: 58,448,953 (GRCm39) *304L probably null Het
Zbtb12 T A 17: 35,115,377 (GRCm39) H387Q possibly damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,503,692 (GRCm39) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,493,939 (GRCm39) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,510,669 (GRCm39) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,511,773 (GRCm39) missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139,500,699 (GRCm39) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,498,760 (GRCm39) missense probably benign 0.01
R8134:Kndc1 UTSW 7 139,481,285 (GRCm39) splice site probably null
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,481,121 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,490,130 (GRCm39) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9510:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,490,729 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTAGAATCACAGGCACGCTCAC -3'
(R):5'- CCCCTGCTTTCTTGAGGAAG -3'

Sequencing Primer
(F):5'- AGGCACGCTCACTCATTG -3'
(R):5'- AAGCAGTAAGGGCCCTTCCAG -3'
Posted On 2015-10-21