Incidental Mutation 'R4705:Pknox2'
ID355132
Institutional Source Beutler Lab
Gene Symbol Pknox2
Ensembl Gene ENSMUSG00000035934
Gene NamePbx/knotted 1 homeobox 2
SynonymsD230005H23Rik, Prep2
MMRRC Submission 041953-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R4705 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location36890982-37147407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36923638 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 178 (N178K)
Ref Sequence ENSEMBL: ENSMUSP00000135581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039674] [ENSMUST00000080754] [ENSMUST00000175938] [ENSMUST00000177218]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039674
AA Change: N178K

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035806
Gene: ENSMUSG00000035934
AA Change: N178K

DomainStartEndE-ValueType
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000080754
AA Change: N178K

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079578
Gene: ENSMUSG00000035934
AA Change: N178K

DomainStartEndE-ValueType
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177080
SMART Domains Protein: ENSMUSP00000135444
Gene: ENSMUSG00000035934

DomainStartEndE-ValueType
HOX 259 324 4.4e-14 SMART
low complexity region 386 395 N/A INTRINSIC
coiled coil region 399 436 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177218
AA Change: N178K

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135581
Gene: ENSMUSG00000035934
AA Change: N178K

DomainStartEndE-ValueType
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Meta Mutation Damage Score 0.1813 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 96% (113/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeodomain proteins are sequence-specific transcription factors that share a highly conserved DNA-binding domain and play fundamental roles in cell proliferation, differentiation, and death. PKNOX2 belongs to the TALE (3-amino acid loop extension) class of homeodomain proteins characterized by a 3-amino acid extension between alpha helices 1 and 2 within the homeodomain (Imoto et al., 2001 [PubMed 11549286]).[supplied by OMIM, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,635 N325D possibly damaging Het
1700056E22Rik A G 1: 184,033,172 V230A possibly damaging Het
2010315B03Rik T C 9: 124,294,001 T123A possibly damaging Het
4932438A13Rik C T 3: 37,041,889 T1108I probably benign Het
Abca4 T C 3: 122,105,370 V667A probably damaging Het
Abcb5 A G 12: 118,965,305 S4P possibly damaging Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Ahnak C A 19: 9,016,906 H5185N probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
Atf7ip C T 6: 136,561,194 P483L probably damaging Het
Atp11a C G 8: 12,813,118 P99R probably damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bag6 C A 17: 35,142,343 P476H probably damaging Het
BC049730 T A 7: 24,713,509 L114Q probably damaging Het
C2cd3 A G 7: 100,395,188 K326E possibly damaging Het
Casp1 A G 9: 5,306,204 D363G probably damaging Het
Ccdc33 G T 9: 58,117,557 Q129K probably benign Het
Ccdc88a T C 11: 29,422,586 I107T probably benign Het
Cela2a T C 4: 141,821,411 N138S probably benign Het
Cfap61 A C 2: 146,035,202 R460S probably damaging Het
Clstn2 T C 9: 97,463,559 N579D possibly damaging Het
Col13a1 C A 10: 61,850,165 G683W unknown Het
Col4a2 G A 8: 11,313,504 R14Q possibly damaging Het
Cpa6 A G 1: 10,481,058 S164P probably benign Het
Cpq A G 15: 33,497,338 N408S probably benign Het
Ctnnal1 T C 4: 56,812,579 T690A probably benign Het
Cx3cl1 A T 8: 94,780,207 N280I probably benign Het
Cyp2b19 C T 7: 26,757,292 R36C probably benign Het
Ddx51 T C 5: 110,655,308 V269A probably damaging Het
Dlst G T 12: 85,118,842 probably null Het
Dmkn G C 7: 30,763,981 A20P probably damaging Het
Dnhd1 T C 7: 105,655,741 I330T probably damaging Het
Dock3 G A 9: 107,025,336 H292Y probably damaging Het
Ell A G 8: 70,578,934 D94G possibly damaging Het
Enam T A 5: 88,503,791 L1053* probably null Het
Fcgbp A G 7: 28,107,296 K2230E probably benign Het
Frmd5 G T 2: 121,562,863 probably benign Het
Gas2l1 G A 11: 5,060,867 S654L possibly damaging Het
Gltpd2 G T 11: 70,520,140 E86* probably null Het
Glyat T C 19: 12,651,297 L152P possibly damaging Het
Gm17330 T C 12: 23,968,782 T22A probably damaging Het
Gm9931 T A 1: 147,281,853 noncoding transcript Het
Gpatch1 A T 7: 35,299,305 probably null Het
Gpr4 T C 7: 19,222,894 L247P probably damaging Het
Gtpbp3 G A 8: 71,491,114 E214K probably benign Het
Hdac7 G T 15: 97,811,587 Q21K probably damaging Het
Hivep3 A G 4: 119,872,050 probably benign Het
Hk2 C T 6: 82,739,650 M300I possibly damaging Het
Ighv1-61 T C 12: 115,359,279 Y71C probably damaging Het
Il1f8 T C 2: 24,154,618 V10A probably benign Het
Inpp5f G T 7: 128,663,987 S152I probably damaging Het
Jag1 C A 2: 137,096,309 W257L probably damaging Het
Jak2 T A 19: 29,294,915 N612K possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kbtbd6 A G 14: 79,452,606 D247G probably benign Het
Kif15 A G 9: 122,959,993 probably null Het
Kndc1 A G 7: 139,930,123 T1293A possibly damaging Het
Lpar5 T C 6: 125,082,207 I297T possibly damaging Het
Lpin2 T A 17: 71,232,143 probably benign Het
Mfsd4a A T 1: 132,053,571 L230Q probably damaging Het
Mmp8 T C 9: 7,565,549 V313A probably benign Het
Mrpl19 A T 6: 81,964,285 D98E probably damaging Het
Mybl1 A G 1: 9,690,115 I86T probably damaging Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Necab1 T C 4: 15,052,628 T117A probably damaging Het
Nol11 A G 11: 107,184,718 probably benign Het
Nucb2 G A 7: 116,540,027 probably null Het
Nupl1 G T 14: 60,251,215 P19T unknown Het
Odf2 T A 2: 29,904,034 L301Q probably damaging Het
Oit1 T C 14: 8,349,347 E201G probably benign Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr736 A G 14: 50,392,800 I15V probably benign Het
Oog4 T C 4: 143,438,875 Y234C probably benign Het
Papln T C 12: 83,777,208 probably null Het
Paqr6 C T 3: 88,365,929 A76V probably benign Het
Pclo A G 5: 14,676,480 probably benign Het
Pdzd8 T C 19: 59,345,311 T93A possibly damaging Het
Pkdrej A T 15: 85,821,167 Y189* probably null Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plxnd1 A C 6: 115,958,620 L1735R probably damaging Het
Polm T A 11: 5,837,663 D30V possibly damaging Het
Rap1gap2 T A 11: 74,437,439 I100F probably damaging Het
Rasgef1c T A 11: 49,978,467 W414R probably benign Het
Rassf1 A G 9: 107,557,867 D187G probably benign Het
Rhag T C 17: 40,836,438 I397T probably benign Het
Rnft2 A G 5: 118,228,863 F269S probably damaging Het
Rnmt T C 18: 68,314,125 F360S probably damaging Het
Ror2 C T 13: 53,117,297 A329T probably benign Het
Slc4a1 T A 11: 102,356,258 N501I possibly damaging Het
Slc4a7 T A 14: 14,733,856 S89T probably damaging Het
Sptbn1 G A 11: 30,100,660 H2310Y probably benign Het
Tbc1d9b C A 11: 50,140,462 N103K probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tmem100 C T 11: 90,035,563 T72I probably damaging Het
Ttc38 A G 15: 85,852,963 T350A probably benign Het
Ubr4 C T 4: 139,450,529 T3241M probably damaging Het
Unc13d A T 11: 116,073,388 M350K possibly damaging Het
Vit T C 17: 78,625,114 I550T probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Zbtb12 T A 17: 34,896,401 H387Q possibly damaging Het
Other mutations in Pknox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Pknox2 APN 9 36923742 missense probably damaging 1.00
IGL02019:Pknox2 APN 9 36923633 missense probably damaging 1.00
IGL02706:Pknox2 APN 9 36936379 missense probably benign 0.18
IGL03018:Pknox2 APN 9 36954697 missense probably damaging 1.00
IGL03374:Pknox2 APN 9 36923670 missense probably damaging 0.98
PIT4494001:Pknox2 UTSW 9 36954691 critical splice donor site probably null
R0585:Pknox2 UTSW 9 36909760 splice site probably benign
R1786:Pknox2 UTSW 9 36909684 missense probably damaging 1.00
R1843:Pknox2 UTSW 9 36954831 missense possibly damaging 0.77
R1861:Pknox2 UTSW 9 36923661 missense probably damaging 1.00
R2252:Pknox2 UTSW 9 36910520 missense probably benign 0.12
R2696:Pknox2 UTSW 9 36909691 nonsense probably null
R2843:Pknox2 UTSW 9 36894328 missense probably benign 0.00
R4576:Pknox2 UTSW 9 36923548 intron probably benign
R4632:Pknox2 UTSW 9 36894413 missense probably benign 0.00
R4754:Pknox2 UTSW 9 36909720 missense probably damaging 0.98
R5974:Pknox2 UTSW 9 36936322 missense probably damaging 1.00
R5984:Pknox2 UTSW 9 36923726 missense probably damaging 1.00
R7014:Pknox2 UTSW 9 36909667 missense probably damaging 1.00
R7387:Pknox2 UTSW 9 36957068 intron probably benign
R7488:Pknox2 UTSW 9 36954831 missense probably benign 0.26
R7769:Pknox2 UTSW 9 36895306 splice site probably null
R8221:Pknox2 UTSW 9 36909744 missense possibly damaging 0.86
R8296:Pknox2 UTSW 9 36911163 missense probably benign 0.31
RF016:Pknox2 UTSW 9 36909609 critical splice donor site probably benign
RF061:Pknox2 UTSW 9 36909609 critical splice donor site probably benign
X0063:Pknox2 UTSW 9 36923769 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCGCCTAATGGAGAGATGAG -3'
(R):5'- TACGAGCTACATCGAGGACG -3'

Sequencing Primer
(F):5'- TGAGGGCTGCATTATAAAAAGATCTG -3'
(R):5'- TACATCGAGGACGGGCTTTC -3'
Posted On2015-10-21