Incidental Mutation 'R4705:Ascc1'
ID 355139
Institutional Source Beutler Lab
Gene Symbol Ascc1
Ensembl Gene ENSMUSG00000044475
Gene Name activating signal cointegrator 1 complex subunit 1
Synonyms CGI-18, ASC1p50, 1810015P09Rik
MMRRC Submission 041953-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.920) question?
Stock # R4705 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 59838627-59935810 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59885624 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 225 (Y225C)
Ref Sequence ENSEMBL: ENSMUSP00000126301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050516] [ENSMUST00000164083]
AlphaFold Q9D8Z1
Predicted Effect probably damaging
Transcript: ENSMUST00000050516
AA Change: Y225C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052351
Gene: ENSMUSG00000044475
AA Change: Y225C

DomainStartEndE-ValueType
KH 56 124 9.05e-6 SMART
Pfam:AKAP7_NLS 132 355 4.3e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164083
AA Change: Y225C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126301
Gene: ENSMUSG00000044475
AA Change: Y225C

DomainStartEndE-ValueType
KH 56 124 9.05e-6 SMART
Pfam:AKAP7_NLS 132 355 3e-63 PFAM
Meta Mutation Damage Score 0.4455 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 96% (113/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the activating signal cointegrator 1 (ASC-1) complex. The ASC-1 complex is a transcriptional coactivator that plays an important role in gene transactivation by multiple transcription factors including activating protein 1 (AP-1), nuclear factor kappa-B (NF-kB) and serum response factor (SRF). The encoded protein contains an N-terminal KH-type RNA-binding motif which is required for AP-1 transactivation by the ASC-1 complex. Mutations in this gene are associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 183,765,369 (GRCm39) V230A possibly damaging Het
2010315B03Rik T C 9: 124,056,631 (GRCm39) T123A possibly damaging Het
Abca4 T C 3: 121,899,019 (GRCm39) V667A probably damaging Het
Abcb5 A G 12: 118,929,040 (GRCm39) S4P possibly damaging Het
Adam25 G T 8: 41,207,163 (GRCm39) C143F probably damaging Het
Ahnak C A 19: 8,994,270 (GRCm39) H5185N probably benign Het
Apobec4 A G 1: 152,632,001 (GRCm39) T10A probably benign Het
Aspscr1 A T 11: 120,579,771 (GRCm39) K39N possibly damaging Het
Atf7ip C T 6: 136,538,192 (GRCm39) P483L probably damaging Het
Atp11a C G 8: 12,863,118 (GRCm39) P99R probably damaging Het
B4galnt1 G T 10: 127,003,394 (GRCm39) V172F possibly damaging Het
Bag6 C A 17: 35,361,319 (GRCm39) P476H probably damaging Het
Bltp1 C T 3: 37,096,038 (GRCm39) T1108I probably benign Het
C2cd3 A G 7: 100,044,395 (GRCm39) K326E possibly damaging Het
Casp1 A G 9: 5,306,204 (GRCm39) D363G probably damaging Het
Ccdc33 G T 9: 58,024,840 (GRCm39) Q129K probably benign Het
Ccdc88a T C 11: 29,372,586 (GRCm39) I107T probably benign Het
Cela2a T C 4: 141,548,722 (GRCm39) N138S probably benign Het
Cfap61 A C 2: 145,877,122 (GRCm39) R460S probably damaging Het
Clstn2 T C 9: 97,345,612 (GRCm39) N579D possibly damaging Het
Col13a1 C A 10: 61,685,944 (GRCm39) G683W unknown Het
Col4a2 G A 8: 11,363,504 (GRCm39) R14Q possibly damaging Het
Cpa6 A G 1: 10,551,283 (GRCm39) S164P probably benign Het
Cpq A G 15: 33,497,484 (GRCm39) N408S probably benign Het
Ctnnal1 T C 4: 56,812,579 (GRCm39) T690A probably benign Het
Cx3cl1 A T 8: 95,506,835 (GRCm39) N280I probably benign Het
Cyp2b19 C T 7: 26,456,717 (GRCm39) R36C probably benign Het
Ddx51 T C 5: 110,803,174 (GRCm39) V269A probably damaging Het
Dipk2a T C 9: 94,402,688 (GRCm39) N325D possibly damaging Het
Dlst G T 12: 85,165,616 (GRCm39) probably null Het
Dmkn G C 7: 30,463,406 (GRCm39) A20P probably damaging Het
Dnhd1 T C 7: 105,304,948 (GRCm39) I330T probably damaging Het
Dock3 G A 9: 106,902,535 (GRCm39) H292Y probably damaging Het
Ell A G 8: 71,031,584 (GRCm39) D94G possibly damaging Het
Enam T A 5: 88,651,650 (GRCm39) L1053* probably null Het
Fam3d T C 14: 8,349,347 (GRCm38) E201G probably benign Het
Fcgbp A G 7: 27,806,721 (GRCm39) K2230E probably benign Het
Frmd5 G T 2: 121,393,344 (GRCm39) probably benign Het
Gas2l1 G A 11: 5,010,867 (GRCm39) S654L possibly damaging Het
Gltpd2 G T 11: 70,410,966 (GRCm39) E86* probably null Het
Glyat T C 19: 12,628,661 (GRCm39) L152P possibly damaging Het
Gm17330 T C 12: 24,018,783 (GRCm39) T22A probably damaging Het
Gm9931 T A 1: 147,157,591 (GRCm39) noncoding transcript Het
Gpatch1 A T 7: 34,998,730 (GRCm39) probably null Het
Gpr4 T C 7: 18,956,819 (GRCm39) L247P probably damaging Het
Gtpbp3 G A 8: 71,943,758 (GRCm39) E214K probably benign Het
Hdac7 G T 15: 97,709,468 (GRCm39) Q21K probably damaging Het
Hivep3 A G 4: 119,729,247 (GRCm39) probably benign Het
Hk2 C T 6: 82,716,631 (GRCm39) M300I possibly damaging Het
Ighv1-61 T C 12: 115,322,899 (GRCm39) Y71C probably damaging Het
Il36b T C 2: 24,044,630 (GRCm39) V10A probably benign Het
Inpp5f G T 7: 128,265,711 (GRCm39) S152I probably damaging Het
Jag1 C A 2: 136,938,229 (GRCm39) W257L probably damaging Het
Jak2 T A 19: 29,272,315 (GRCm39) N612K possibly damaging Het
Kalrn T C 16: 34,024,327 (GRCm39) D610G probably damaging Het
Kbtbd6 A G 14: 79,690,046 (GRCm39) D247G probably benign Het
Kif15 A G 9: 122,789,058 (GRCm39) probably null Het
Kndc1 A G 7: 139,510,036 (GRCm39) T1293A possibly damaging Het
Lpar5 T C 6: 125,059,170 (GRCm39) I297T possibly damaging Het
Lpin2 T A 17: 71,539,138 (GRCm39) probably benign Het
Lypd10 T A 7: 24,412,934 (GRCm39) L114Q probably damaging Het
Mfsd4a A T 1: 131,981,309 (GRCm39) L230Q probably damaging Het
Mmp8 T C 9: 7,565,550 (GRCm39) V313A probably benign Het
Mrpl19 A T 6: 81,941,266 (GRCm39) D98E probably damaging Het
Mybl1 A G 1: 9,760,340 (GRCm39) I86T probably damaging Het
Nadk C A 4: 155,669,684 (GRCm39) P157T probably benign Het
Necab1 T C 4: 15,052,628 (GRCm39) T117A probably damaging Het
Nol11 A G 11: 107,075,544 (GRCm39) probably benign Het
Nucb2 G A 7: 116,139,262 (GRCm39) probably null Het
Nup58 G T 14: 60,488,664 (GRCm39) P19T unknown Het
Odf2 T A 2: 29,794,046 (GRCm39) L301Q probably damaging Het
Oog4 T C 4: 143,165,445 (GRCm39) Y234C probably benign Het
Or11j4 A G 14: 50,630,257 (GRCm39) I15V probably benign Het
Or1ab2 T A 8: 72,864,044 (GRCm39) F211L probably damaging Het
Papln T C 12: 83,823,982 (GRCm39) probably null Het
Paqr6 C T 3: 88,273,236 (GRCm39) A76V probably benign Het
Pclo A G 5: 14,726,494 (GRCm39) probably benign Het
Pdzd8 T C 19: 59,333,743 (GRCm39) T93A possibly damaging Het
Pkdrej A T 15: 85,705,368 (GRCm39) Y189* probably null Het
Pknox2 A T 9: 36,834,934 (GRCm39) N178K possibly damaging Het
Pla2g15 T A 8: 106,889,691 (GRCm39) M321K probably benign Het
Plxnd1 A C 6: 115,935,581 (GRCm39) L1735R probably damaging Het
Polm T A 11: 5,787,663 (GRCm39) D30V possibly damaging Het
Rap1gap2 T A 11: 74,328,265 (GRCm39) I100F probably damaging Het
Rasgef1c T A 11: 49,869,294 (GRCm39) W414R probably benign Het
Rassf1 A G 9: 107,435,066 (GRCm39) D187G probably benign Het
Rhag T C 17: 41,147,329 (GRCm39) I397T probably benign Het
Rnft2 A G 5: 118,366,928 (GRCm39) F269S probably damaging Het
Rnmt T C 18: 68,447,196 (GRCm39) F360S probably damaging Het
Ror2 C T 13: 53,271,333 (GRCm39) A329T probably benign Het
Slc4a1 T A 11: 102,247,084 (GRCm39) N501I possibly damaging Het
Slc4a7 T A 14: 14,733,856 (GRCm38) S89T probably damaging Het
Sptbn1 G A 11: 30,050,660 (GRCm39) H2310Y probably benign Het
Tbc1d9b C A 11: 50,031,289 (GRCm39) N103K probably benign Het
Tbxas1 T C 6: 39,060,791 (GRCm39) probably null Het
Tmem100 C T 11: 89,926,389 (GRCm39) T72I probably damaging Het
Ttc38 A G 15: 85,737,164 (GRCm39) T350A probably benign Het
Ubr4 C T 4: 139,177,840 (GRCm39) T3241M probably damaging Het
Unc13d A T 11: 115,964,214 (GRCm39) M350K possibly damaging Het
Vit T C 17: 78,932,543 (GRCm39) I550T probably damaging Het
Vmn1r31 C A 6: 58,448,953 (GRCm39) *304L probably null Het
Zbtb12 T A 17: 35,115,377 (GRCm39) H387Q possibly damaging Het
Other mutations in Ascc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Ascc1 APN 10 59,848,280 (GRCm39) splice site probably benign
Dagger UTSW 10 59,849,475 (GRCm39) missense probably damaging 1.00
stiletto UTSW 10 59,840,641 (GRCm39) start codon destroyed probably damaging 1.00
R1307:Ascc1 UTSW 10 59,848,321 (GRCm39) missense probably benign 0.00
R1463:Ascc1 UTSW 10 59,898,338 (GRCm39) missense probably benign 0.17
R2403:Ascc1 UTSW 10 59,840,663 (GRCm39) missense probably benign 0.20
R4308:Ascc1 UTSW 10 59,849,434 (GRCm39) missense probably benign 0.00
R4703:Ascc1 UTSW 10 59,885,624 (GRCm39) missense probably damaging 1.00
R4704:Ascc1 UTSW 10 59,885,624 (GRCm39) missense probably damaging 1.00
R4916:Ascc1 UTSW 10 59,840,684 (GRCm39) missense probably benign 0.01
R6906:Ascc1 UTSW 10 59,840,674 (GRCm39) missense probably benign 0.01
R6944:Ascc1 UTSW 10 59,849,475 (GRCm39) missense probably damaging 1.00
R7227:Ascc1 UTSW 10 59,843,560 (GRCm39) missense probably benign 0.08
R7661:Ascc1 UTSW 10 59,885,629 (GRCm39) missense probably damaging 1.00
R7766:Ascc1 UTSW 10 59,840,641 (GRCm39) start codon destroyed probably damaging 1.00
R7940:Ascc1 UTSW 10 59,848,381 (GRCm39) missense probably null 1.00
R8104:Ascc1 UTSW 10 59,843,551 (GRCm39) missense probably benign
R8721:Ascc1 UTSW 10 59,933,928 (GRCm39) missense possibly damaging 0.91
R9189:Ascc1 UTSW 10 59,843,645 (GRCm39) missense probably benign 0.00
Z1176:Ascc1 UTSW 10 59,843,615 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ACAGCTAGACTATGTTGCTGG -3'
(R):5'- AACAGTCACAATCTGTCTTCTCTG -3'

Sequencing Primer
(F):5'- GCTAGACTATGTTGCTGGAAAAACCC -3'
(R):5'- CTGGTGCAAACATGGAATCCTAGTAC -3'
Posted On 2015-10-21