Incidental Mutation 'R4705:Aspscr1'
ID355155
Institutional Source Beutler Lab
Gene Symbol Aspscr1
Ensembl Gene ENSMUSG00000025142
Gene Namealveolar soft part sarcoma chromosome region, candidate 1 (human)
SynonymsASPCR1, RCC17, TUG, ASPC, ASPL, 1190006K01Rik
MMRRC Submission 041953-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4705 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120672973-120709447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120688945 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 39 (K39N)
Ref Sequence ENSEMBL: ENSMUSP00000125931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026135] [ENSMUST00000103016] [ENSMUST00000106158] [ENSMUST00000106159] [ENSMUST00000106160] [ENSMUST00000131727] [ENSMUST00000135346] [ENSMUST00000143844] [ENSMUST00000149389] [ENSMUST00000151160] [ENSMUST00000153346] [ENSMUST00000168510] [ENSMUST00000168097] [ENSMUST00000168714]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026135
AA Change: K180N

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026135
Gene: ENSMUSG00000025142
AA Change: K180N

DomainStartEndE-ValueType
Pfam:TUG-UBL1 15 78 1.4e-29 PFAM
low complexity region 193 206 N/A INTRINSIC
low complexity region 284 313 N/A INTRINSIC
coiled coil region 339 365 N/A INTRINSIC
UBX 378 459 1.67e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103016
AA Change: K103N

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099305
Gene: ENSMUSG00000025142
AA Change: K103N

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106158
AA Change: K103N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101764
Gene: ENSMUSG00000025142
AA Change: K103N

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106159
AA Change: K103N

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101765
Gene: ENSMUSG00000025142
AA Change: K103N

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106160
AA Change: K103N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101766
Gene: ENSMUSG00000025142
AA Change: K103N

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131727
AA Change: K103N

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117654
Gene: ENSMUSG00000025142
AA Change: K103N

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135346
AA Change: K103N

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120072
Gene: ENSMUSG00000025142
AA Change: K103N

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143844
Predicted Effect probably benign
Transcript: ENSMUST00000149389
AA Change: K165N

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000122216
Gene: ENSMUSG00000025142
AA Change: K165N

DomainStartEndE-ValueType
Pfam:TUG-UBL1 3 63 3.7e-24 PFAM
low complexity region 178 191 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000151160
AA Change: K103N

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116447
Gene: ENSMUSG00000025142
AA Change: K103N

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163273
Predicted Effect possibly damaging
Transcript: ENSMUST00000168510
AA Change: K39N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125931
Gene: ENSMUSG00000025142
AA Change: K39N

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166838
SMART Domains Protein: ENSMUSP00000127202
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
coiled coil region 49 75 N/A INTRINSIC
Blast:UBX 89 119 7e-13 BLAST
SCOP:d1i42a_ 92 119 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167678
SMART Domains Protein: ENSMUSP00000128940
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
coiled coil region 37 63 N/A INTRINSIC
Blast:UBX 77 107 8e-13 BLAST
SCOP:d1i42a_ 80 107 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168097
Predicted Effect probably benign
Transcript: ENSMUST00000168714
SMART Domains Protein: ENSMUSP00000129462
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
SCOP:d1h8ca_ 12 82 2e-4 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 96% (113/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBX domain and interacts with glucose transporter type 4 (GLUT4). This protein is a tether, which sequesters the GLUT4 in intracellular vesicles in muscle and fat cells in the absence of insulin, and redistributes the GLUT4 to the plasma membrane within minutes of insulin stimulation. Translocation t(X;17)(p11;q25) of this gene with transcription factor TFE3 gene results in a ASPSCR1-TFE3 fusion protein in alveolar soft part sarcoma and in renal cell carcinomas. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,635 N325D possibly damaging Het
1700056E22Rik A G 1: 184,033,172 V230A possibly damaging Het
2010315B03Rik T C 9: 124,294,001 T123A possibly damaging Het
4932438A13Rik C T 3: 37,041,889 T1108I probably benign Het
Abca4 T C 3: 122,105,370 V667A probably damaging Het
Abcb5 A G 12: 118,965,305 S4P possibly damaging Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Ahnak C A 19: 9,016,906 H5185N probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Atf7ip C T 6: 136,561,194 P483L probably damaging Het
Atp11a C G 8: 12,813,118 P99R probably damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bag6 C A 17: 35,142,343 P476H probably damaging Het
BC049730 T A 7: 24,713,509 L114Q probably damaging Het
C2cd3 A G 7: 100,395,188 K326E possibly damaging Het
Casp1 A G 9: 5,306,204 D363G probably damaging Het
Ccdc33 G T 9: 58,117,557 Q129K probably benign Het
Ccdc88a T C 11: 29,422,586 I107T probably benign Het
Cela2a T C 4: 141,821,411 N138S probably benign Het
Cfap61 A C 2: 146,035,202 R460S probably damaging Het
Clstn2 T C 9: 97,463,559 N579D possibly damaging Het
Col13a1 C A 10: 61,850,165 G683W unknown Het
Col4a2 G A 8: 11,313,504 R14Q possibly damaging Het
Cpa6 A G 1: 10,481,058 S164P probably benign Het
Cpq A G 15: 33,497,338 N408S probably benign Het
Ctnnal1 T C 4: 56,812,579 T690A probably benign Het
Cx3cl1 A T 8: 94,780,207 N280I probably benign Het
Cyp2b19 C T 7: 26,757,292 R36C probably benign Het
Ddx51 T C 5: 110,655,308 V269A probably damaging Het
Dlst G T 12: 85,118,842 probably null Het
Dmkn G C 7: 30,763,981 A20P probably damaging Het
Dnhd1 T C 7: 105,655,741 I330T probably damaging Het
Dock3 G A 9: 107,025,336 H292Y probably damaging Het
Ell A G 8: 70,578,934 D94G possibly damaging Het
Enam T A 5: 88,503,791 L1053* probably null Het
Fcgbp A G 7: 28,107,296 K2230E probably benign Het
Frmd5 G T 2: 121,562,863 probably benign Het
Gas2l1 G A 11: 5,060,867 S654L possibly damaging Het
Gltpd2 G T 11: 70,520,140 E86* probably null Het
Glyat T C 19: 12,651,297 L152P possibly damaging Het
Gm17330 T C 12: 23,968,782 T22A probably damaging Het
Gm9931 T A 1: 147,281,853 noncoding transcript Het
Gpatch1 A T 7: 35,299,305 probably null Het
Gpr4 T C 7: 19,222,894 L247P probably damaging Het
Gtpbp3 G A 8: 71,491,114 E214K probably benign Het
Hdac7 G T 15: 97,811,587 Q21K probably damaging Het
Hivep3 A G 4: 119,872,050 probably benign Het
Hk2 C T 6: 82,739,650 M300I possibly damaging Het
Ighv1-61 T C 12: 115,359,279 Y71C probably damaging Het
Il1f8 T C 2: 24,154,618 V10A probably benign Het
Inpp5f G T 7: 128,663,987 S152I probably damaging Het
Jag1 C A 2: 137,096,309 W257L probably damaging Het
Jak2 T A 19: 29,294,915 N612K possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kbtbd6 A G 14: 79,452,606 D247G probably benign Het
Kif15 A G 9: 122,959,993 probably null Het
Kndc1 A G 7: 139,930,123 T1293A possibly damaging Het
Lpar5 T C 6: 125,082,207 I297T possibly damaging Het
Lpin2 T A 17: 71,232,143 probably benign Het
Mfsd4a A T 1: 132,053,571 L230Q probably damaging Het
Mmp8 T C 9: 7,565,549 V313A probably benign Het
Mrpl19 A T 6: 81,964,285 D98E probably damaging Het
Mybl1 A G 1: 9,690,115 I86T probably damaging Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Necab1 T C 4: 15,052,628 T117A probably damaging Het
Nol11 A G 11: 107,184,718 probably benign Het
Nucb2 G A 7: 116,540,027 probably null Het
Nupl1 G T 14: 60,251,215 P19T unknown Het
Odf2 T A 2: 29,904,034 L301Q probably damaging Het
Oit1 T C 14: 8,349,347 E201G probably benign Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr736 A G 14: 50,392,800 I15V probably benign Het
Oog4 T C 4: 143,438,875 Y234C probably benign Het
Papln T C 12: 83,777,208 probably null Het
Paqr6 C T 3: 88,365,929 A76V probably benign Het
Pclo A G 5: 14,676,480 probably benign Het
Pdzd8 T C 19: 59,345,311 T93A possibly damaging Het
Pkdrej A T 15: 85,821,167 Y189* probably null Het
Pknox2 A T 9: 36,923,638 N178K possibly damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plxnd1 A C 6: 115,958,620 L1735R probably damaging Het
Polm T A 11: 5,837,663 D30V possibly damaging Het
Rap1gap2 T A 11: 74,437,439 I100F probably damaging Het
Rasgef1c T A 11: 49,978,467 W414R probably benign Het
Rassf1 A G 9: 107,557,867 D187G probably benign Het
Rhag T C 17: 40,836,438 I397T probably benign Het
Rnft2 A G 5: 118,228,863 F269S probably damaging Het
Rnmt T C 18: 68,314,125 F360S probably damaging Het
Ror2 C T 13: 53,117,297 A329T probably benign Het
Slc4a1 T A 11: 102,356,258 N501I possibly damaging Het
Slc4a7 T A 14: 14,733,856 S89T probably damaging Het
Sptbn1 G A 11: 30,100,660 H2310Y probably benign Het
Tbc1d9b C A 11: 50,140,462 N103K probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tmem100 C T 11: 90,035,563 T72I probably damaging Het
Ttc38 A G 15: 85,852,963 T350A probably benign Het
Ubr4 C T 4: 139,450,529 T3241M probably damaging Het
Unc13d A T 11: 116,073,388 M350K possibly damaging Het
Vit T C 17: 78,625,114 I550T probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Zbtb12 T A 17: 34,896,401 H387Q possibly damaging Het
Other mutations in Aspscr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02588:Aspscr1 APN 11 120677531 missense possibly damaging 0.93
IGL02683:Aspscr1 APN 11 120701226 missense probably damaging 1.00
IGL02719:Aspscr1 APN 11 120677579 missense probably damaging 1.00
I1329:Aspscr1 UTSW 11 120701240 missense probably damaging 0.99
R0113:Aspscr1 UTSW 11 120688925 missense probably damaging 1.00
R0277:Aspscr1 UTSW 11 120678420 missense probably damaging 1.00
R0323:Aspscr1 UTSW 11 120678420 missense probably damaging 1.00
R0457:Aspscr1 UTSW 11 120677618 missense probably benign 0.35
R0714:Aspscr1 UTSW 11 120703667 critical splice donor site probably null
R1435:Aspscr1 UTSW 11 120689222 missense probably benign 0.00
R1509:Aspscr1 UTSW 11 120701516 missense probably damaging 1.00
R1739:Aspscr1 UTSW 11 120678516 missense probably damaging 1.00
R1789:Aspscr1 UTSW 11 120688560 missense probably damaging 1.00
R1958:Aspscr1 UTSW 11 120689208 missense probably null 1.00
R2414:Aspscr1 UTSW 11 120689222 missense probably benign 0.00
R2432:Aspscr1 UTSW 11 120702566 intron probably benign
R4059:Aspscr1 UTSW 11 120686679 missense probably benign 0.22
R4159:Aspscr1 UTSW 11 120708676 missense probably damaging 1.00
R4703:Aspscr1 UTSW 11 120688945 missense possibly damaging 0.87
R4748:Aspscr1 UTSW 11 120701507 missense probably damaging 0.99
R5141:Aspscr1 UTSW 11 120689177 missense probably benign 0.01
R5869:Aspscr1 UTSW 11 120688920 missense possibly damaging 0.55
R7543:Aspscr1 UTSW 11 120709423 missense unknown
R7555:Aspscr1 UTSW 11 120673100 missense unknown
R7609:Aspscr1 UTSW 11 120677522 missense probably damaging 0.99
R7670:Aspscr1 UTSW 11 120689039 missense probably benign 0.00
R7946:Aspscr1 UTSW 11 120708617 missense
R7999:Aspscr1 UTSW 11 120678522 critical splice donor site probably null
R8299:Aspscr1 UTSW 11 120709074 missense
Predicted Primers PCR Primer
(F):5'- GTGCCTTCAAGGACTACTCC -3'
(R):5'- TAGAGGTCTCAAGGACGCAG -3'

Sequencing Primer
(F):5'- AGGACTACTCCTTCCAGCC -3'
(R):5'- CAGGCTCACTGGTGCTTTGC -3'
Posted On2015-10-21