Mutagenetix > Incidental Mutation

Incidental Mutation 'R4705:Vit'

355174

Institutional Source

Beutler Lab

Gene Symbol

Vit

Ensembl Gene

ENSMUSG00000024076

Gene Name

vitrin

Synonyms

MMRRC Submission

041953-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R4705 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78508063-78627409 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78625114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 550 (I550T)

Ref Sequence

ENSEMBL: ENSMUSP00000024880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024880]

AlphaFold

Q8VHI5

Predicted Effect

probably damaging
Transcript: ENSMUST00000024880
AA Change: I550T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024880
Gene: ENSMUSG00000024076
AA Change: I550T

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
LCCL	42	124	2.5e-45	SMART
low complexity region	148	171	N/A	INTRINSIC
VWA	263	451	7.34e-39	SMART
VWA	465	641	1.02e-46	SMART

Meta Mutation Damage Score

0.7948

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

96% (113/118)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix (ECM) protein. The protein may be associated with cell adhesion and migration. High levels of expression of the protein in specific parts of the brain suggest its likely role in neural development. [provided by RefSeq, Jun 2016]
PHENOTYPE: Embryos homozygous for a knock-out allele show decreased spinal cord size associated with reduced cell proliferation and altered cell differentiation in the central canal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	T	C	9: 94,520,635	N325D	possibly damaging	Het
1700056E22Rik	A	G	1: 184,033,172	V230A	possibly damaging	Het
2010315B03Rik	T	C	9: 124,294,001	T123A	possibly damaging	Het
4932438A13Rik	C	T	3: 37,041,889	T1108I	probably benign	Het
Abca4	T	C	3: 122,105,370	V667A	probably damaging	Het
Abcb5	A	G	12: 118,965,305	S4P	possibly damaging	Het
Adam25	G	T	8: 40,754,126	C143F	probably damaging	Het
Ahnak	C	A	19: 9,016,906	H5185N	probably benign	Het
Apobec4	A	G	1: 152,756,250	T10A	probably benign	Het
Ascc1	A	G	10: 60,049,802	Y225C	probably damaging	Het
Aspscr1	A	T	11: 120,688,945	K39N	possibly damaging	Het
Atf7ip	C	T	6: 136,561,194	P483L	probably damaging	Het
Atp11a	C	G	8: 12,813,118	P99R	probably damaging	Het
B4galnt1	G	T	10: 127,167,525	V172F	possibly damaging	Het
Bag6	C	A	17: 35,142,343	P476H	probably damaging	Het
BC049730	T	A	7: 24,713,509	L114Q	probably damaging	Het
C2cd3	A	G	7: 100,395,188	K326E	possibly damaging	Het
Casp1	A	G	9: 5,306,204	D363G	probably damaging	Het
Ccdc33	G	T	9: 58,117,557	Q129K	probably benign	Het
Ccdc88a	T	C	11: 29,422,586	I107T	probably benign	Het
Cela2a	T	C	4: 141,821,411	N138S	probably benign	Het
Cfap61	A	C	2: 146,035,202	R460S	probably damaging	Het
Clstn2	T	C	9: 97,463,559	N579D	possibly damaging	Het
Col13a1	C	A	10: 61,850,165	G683W	unknown	Het
Col4a2	G	A	8: 11,313,504	R14Q	possibly damaging	Het
Cpa6	A	G	1: 10,481,058	S164P	probably benign	Het
Cpq	A	G	15: 33,497,338	N408S	probably benign	Het
Ctnnal1	T	C	4: 56,812,579	T690A	probably benign	Het
Cx3cl1	A	T	8: 94,780,207	N280I	probably benign	Het
Cyp2b19	C	T	7: 26,757,292	R36C	probably benign	Het
Ddx51	T	C	5: 110,655,308	V269A	probably damaging	Het
Dlst	G	T	12: 85,118,842		probably null	Het
Dmkn	G	C	7: 30,763,981	A20P	probably damaging	Het
Dnhd1	T	C	7: 105,655,741	I330T	probably damaging	Het
Dock3	G	A	9: 107,025,336	H292Y	probably damaging	Het
Ell	A	G	8: 70,578,934	D94G	possibly damaging	Het
Enam	T	A	5: 88,503,791	L1053*	probably null	Het
Fcgbp	A	G	7: 28,107,296	K2230E	probably benign	Het
Frmd5	G	T	2: 121,562,863		probably benign	Het
Gas2l1	G	A	11: 5,060,867	S654L	possibly damaging	Het
Gltpd2	G	T	11: 70,520,140	E86*	probably null	Het
Glyat	T	C	19: 12,651,297	L152P	possibly damaging	Het
Gm17330	T	C	12: 23,968,782	T22A	probably damaging	Het
Gm9931	T	A	1: 147,281,853		noncoding transcript	Het
Gpatch1	A	T	7: 35,299,305		probably null	Het
Gpr4	T	C	7: 19,222,894	L247P	probably damaging	Het
Gtpbp3	G	A	8: 71,491,114	E214K	probably benign	Het
Hdac7	G	T	15: 97,811,587	Q21K	probably damaging	Het
Hivep3	A	G	4: 119,872,050		probably benign	Het
Hk2	C	T	6: 82,739,650	M300I	possibly damaging	Het
Ighv1-61	T	C	12: 115,359,279	Y71C	probably damaging	Het
Il1f8	T	C	2: 24,154,618	V10A	probably benign	Het
Inpp5f	G	T	7: 128,663,987	S152I	probably damaging	Het
Jag1	C	A	2: 137,096,309	W257L	probably damaging	Het
Jak2	T	A	19: 29,294,915	N612K	possibly damaging	Het
Kalrn	T	C	16: 34,203,957	D610G	probably damaging	Het
Kbtbd6	A	G	14: 79,452,606	D247G	probably benign	Het
Kif15	A	G	9: 122,959,993		probably null	Het
Kndc1	A	G	7: 139,930,123	T1293A	possibly damaging	Het
Lpar5	T	C	6: 125,082,207	I297T	possibly damaging	Het
Lpin2	T	A	17: 71,232,143		probably benign	Het
Mfsd4a	A	T	1: 132,053,571	L230Q	probably damaging	Het
Mmp8	T	C	9: 7,565,549	V313A	probably benign	Het
Mrpl19	A	T	6: 81,964,285	D98E	probably damaging	Het
Mybl1	A	G	1: 9,690,115	I86T	probably damaging	Het
Nadk	C	A	4: 155,585,227	P157T	probably benign	Het
Necab1	T	C	4: 15,052,628	T117A	probably damaging	Het
Nol11	A	G	11: 107,184,718		probably benign	Het
Nucb2	G	A	7: 116,540,027		probably null	Het
Nupl1	G	T	14: 60,251,215	P19T	unknown	Het
Odf2	T	A	2: 29,904,034	L301Q	probably damaging	Het
Oit1	T	C	14: 8,349,347	E201G	probably benign	Het
Olfr374	T	A	8: 72,110,200	F211L	probably damaging	Het
Olfr736	A	G	14: 50,392,800	I15V	probably benign	Het
Oog4	T	C	4: 143,438,875	Y234C	probably benign	Het
Papln	T	C	12: 83,777,208		probably null	Het
Paqr6	C	T	3: 88,365,929	A76V	probably benign	Het
Pclo	A	G	5: 14,676,480		probably benign	Het
Pdzd8	T	C	19: 59,345,311	T93A	possibly damaging	Het
Pkdrej	A	T	15: 85,821,167	Y189*	probably null	Het
Pknox2	A	T	9: 36,923,638	N178K	possibly damaging	Het
Pla2g15	T	A	8: 106,163,059	M321K	probably benign	Het
Plxnd1	A	C	6: 115,958,620	L1735R	probably damaging	Het
Polm	T	A	11: 5,837,663	D30V	possibly damaging	Het
Rap1gap2	T	A	11: 74,437,439	I100F	probably damaging	Het
Rasgef1c	T	A	11: 49,978,467	W414R	probably benign	Het
Rassf1	A	G	9: 107,557,867	D187G	probably benign	Het
Rhag	T	C	17: 40,836,438	I397T	probably benign	Het
Rnft2	A	G	5: 118,228,863	F269S	probably damaging	Het
Rnmt	T	C	18: 68,314,125	F360S	probably damaging	Het
Ror2	C	T	13: 53,117,297	A329T	probably benign	Het
Slc4a1	T	A	11: 102,356,258	N501I	possibly damaging	Het
Slc4a7	T	A	14: 14,733,856	S89T	probably damaging	Het
Sptbn1	G	A	11: 30,100,660	H2310Y	probably benign	Het
Tbc1d9b	C	A	11: 50,140,462	N103K	probably benign	Het
Tbxas1	T	C	6: 39,083,857		probably null	Het
Tmem100	C	T	11: 90,035,563	T72I	probably damaging	Het
Ttc38	A	G	15: 85,852,963	T350A	probably benign	Het
Ubr4	C	T	4: 139,450,529	T3241M	probably damaging	Het
Unc13d	A	T	11: 116,073,388	M350K	possibly damaging	Het
Vmn1r31	C	A	6: 58,471,968	*304L	probably null	Het
Zbtb12	T	A	17: 34,896,401	H387Q	possibly damaging	Het

Other mutations in Vit

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Vit	APN	17	78601907	critical splice donor site	probably null
IGL00929:Vit	APN	17	78579401	missense	probably damaging	0.98
IGL01447:Vit	APN	17	78625204	missense	probably damaging	1.00
IGL02000:Vit	APN	17	78605486	missense	possibly damaging	0.94
IGL02230:Vit	APN	17	78619627	missense	probably damaging	1.00
IGL02245:Vit	APN	17	78625051	missense	probably damaging	1.00
IGL02315:Vit	APN	17	78622658	missense	possibly damaging	0.80
IGL03133:Vit	APN	17	78566071	missense	probably benign
R0025:Vit	UTSW	17	78599835	missense	probably benign	0.00
R0025:Vit	UTSW	17	78599835	missense	probably benign	0.00
R0520:Vit	UTSW	17	78625159	missense	probably damaging	1.00
R0550:Vit	UTSW	17	78624793	missense	possibly damaging	0.95
R0565:Vit	UTSW	17	78624837	missense	probably damaging	1.00
R0856:Vit	UTSW	17	78619657	missense	possibly damaging	0.53
R1155:Vit	UTSW	17	78566027	missense	probably damaging	1.00
R1327:Vit	UTSW	17	78625200	missense	probably damaging	1.00
R1690:Vit	UTSW	17	78624865	missense	probably damaging	1.00
R1802:Vit	UTSW	17	78605511	missense	possibly damaging	0.91
R1822:Vit	UTSW	17	78622836	missense	probably benign	0.01
R1826:Vit	UTSW	17	78534676	missense	probably benign	0.22
R1827:Vit	UTSW	17	78546446	critical splice donor site	probably null
R1862:Vit	UTSW	17	78622746	missense	probably damaging	1.00
R2235:Vit	UTSW	17	78605438	missense	probably benign	0.01
R2571:Vit	UTSW	17	78586745	missense	probably benign
R4011:Vit	UTSW	17	78534692	splice site	probably benign
R4190:Vit	UTSW	17	78586826	missense	probably benign	0.13
R4191:Vit	UTSW	17	78586826	missense	probably benign	0.13
R4192:Vit	UTSW	17	78586826	missense	probably benign	0.13
R4193:Vit	UTSW	17	78586826	missense	probably benign	0.13
R4635:Vit	UTSW	17	78574212	missense	probably benign	0.01
R4841:Vit	UTSW	17	78601879	missense	probably benign
R4842:Vit	UTSW	17	78601879	missense	probably benign
R4884:Vit	UTSW	17	78624753	missense	probably damaging	0.99
R4923:Vit	UTSW	17	78586841	missense	probably benign	0.03
R5128:Vit	UTSW	17	78625146	missense	probably damaging	1.00
R5272:Vit	UTSW	17	78586835	missense	probably benign
R5779:Vit	UTSW	17	78546426	missense	probably benign
R6596:Vit	UTSW	17	78622845	missense	probably benign	0.35
R6658:Vit	UTSW	17	78622803	missense	possibly damaging	0.93
R6792:Vit	UTSW	17	78579399	missense	probably damaging	1.00
R6894:Vit	UTSW	17	78626758	nonsense	probably null
R7032:Vit	UTSW	17	78624865	missense	probably damaging	1.00
R7061:Vit	UTSW	17	78625156	missense	probably damaging	1.00
R7102:Vit	UTSW	17	78624997	missense	probably damaging	1.00
R7106:Vit	UTSW	17	78586799	missense	probably benign
R7292:Vit	UTSW	17	78605498	missense	probably benign	0.03
R7413:Vit	UTSW	17	78624880	missense	probably damaging	1.00
R8191:Vit	UTSW	17	78546399	missense	probably benign	0.00
R8385:Vit	UTSW	17	78619637	missense	probably benign	0.01
R9106:Vit	UTSW	17	78626849	missense	probably damaging	1.00
R9314:Vit	UTSW	17	78619615	missense	probably benign	0.02
R9433:Vit	UTSW	17	78624984	missense	probably damaging	1.00
R9588:Vit	UTSW	17	78622650	missense	probably damaging	0.98
R9772:Vit	UTSW	17	78624969	missense	probably damaging	1.00
X0023:Vit	UTSW	17	78566164	missense	probably benign
X0064:Vit	UTSW	17	78624885	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCATCGATGGGTCTAGCAG -3'
(R):5'- TCAAGAGATGCTTCTGGGCC -3'

Sequencing Primer
(F):5'- TGGGGACAAGCAACTTCC -3'
(R):5'- CTGGGCCCACGTTTATATTTATAG -3'

Posted On

2015-10-21