Incidental Mutation 'R4705:Rnmt'
ID355175
Institutional Source Beutler Lab
Gene Symbol Rnmt
Ensembl Gene ENSMUSG00000009535
Gene NameRNA (guanine-7-) methyltransferase
Synonyms
MMRRC Submission 041953-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4705 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location68300355-68324852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68314125 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 360 (F360S)
Ref Sequence ENSEMBL: ENSMUSP00000009679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009679] [ENSMUST00000025427] [ENSMUST00000131075] [ENSMUST00000139111]
Predicted Effect probably damaging
Transcript: ENSMUST00000009679
AA Change: F360S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009679
Gene: ENSMUSG00000009535
AA Change: F360S

DomainStartEndE-ValueType
Pfam:Pox_MCEL 125 464 7.5e-128 PFAM
Pfam:Methyltransf_31 184 352 1.2e-8 PFAM
Pfam:Methyltransf_11 191 305 3.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025427
SMART Domains Protein: ENSMUSP00000025427
Gene: ENSMUSG00000009535

DomainStartEndE-ValueType
Pfam:Pox_MCEL 125 317 2.8e-79 PFAM
Pfam:Methyltransf_23 163 349 8.2e-10 PFAM
Pfam:Methyltransf_31 184 375 4.3e-9 PFAM
Pfam:Methyltransf_18 186 308 1.4e-7 PFAM
Pfam:Methyltransf_11 191 305 5.1e-9 PFAM
Pfam:Pox_MCEL 313 409 2.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131075
SMART Domains Protein: ENSMUSP00000122741
Gene: ENSMUSG00000009535

DomainStartEndE-ValueType
Pfam:Pox_MCEL 125 205 3.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139111
SMART Domains Protein: ENSMUSP00000123500
Gene: ENSMUSG00000009535

DomainStartEndE-ValueType
Pfam:Pox_MCEL 125 240 1.2e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151833
Meta Mutation Damage Score 0.8147 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 96% (113/118)
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,635 N325D possibly damaging Het
1700056E22Rik A G 1: 184,033,172 V230A possibly damaging Het
2010315B03Rik T C 9: 124,294,001 T123A possibly damaging Het
4932438A13Rik C T 3: 37,041,889 T1108I probably benign Het
Abca4 T C 3: 122,105,370 V667A probably damaging Het
Abcb5 A G 12: 118,965,305 S4P possibly damaging Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Ahnak C A 19: 9,016,906 H5185N probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
Atf7ip C T 6: 136,561,194 P483L probably damaging Het
Atp11a C G 8: 12,813,118 P99R probably damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bag6 C A 17: 35,142,343 P476H probably damaging Het
BC049730 T A 7: 24,713,509 L114Q probably damaging Het
C2cd3 A G 7: 100,395,188 K326E possibly damaging Het
Casp1 A G 9: 5,306,204 D363G probably damaging Het
Ccdc33 G T 9: 58,117,557 Q129K probably benign Het
Ccdc88a T C 11: 29,422,586 I107T probably benign Het
Cela2a T C 4: 141,821,411 N138S probably benign Het
Cfap61 A C 2: 146,035,202 R460S probably damaging Het
Clstn2 T C 9: 97,463,559 N579D possibly damaging Het
Col13a1 C A 10: 61,850,165 G683W unknown Het
Col4a2 G A 8: 11,313,504 R14Q possibly damaging Het
Cpa6 A G 1: 10,481,058 S164P probably benign Het
Cpq A G 15: 33,497,338 N408S probably benign Het
Ctnnal1 T C 4: 56,812,579 T690A probably benign Het
Cx3cl1 A T 8: 94,780,207 N280I probably benign Het
Cyp2b19 C T 7: 26,757,292 R36C probably benign Het
Ddx51 T C 5: 110,655,308 V269A probably damaging Het
Dlst G T 12: 85,118,842 probably null Het
Dmkn G C 7: 30,763,981 A20P probably damaging Het
Dnhd1 T C 7: 105,655,741 I330T probably damaging Het
Dock3 G A 9: 107,025,336 H292Y probably damaging Het
Ell A G 8: 70,578,934 D94G possibly damaging Het
Enam T A 5: 88,503,791 L1053* probably null Het
Fcgbp A G 7: 28,107,296 K2230E probably benign Het
Frmd5 G T 2: 121,562,863 probably benign Het
Gas2l1 G A 11: 5,060,867 S654L possibly damaging Het
Gltpd2 G T 11: 70,520,140 E86* probably null Het
Glyat T C 19: 12,651,297 L152P possibly damaging Het
Gm17330 T C 12: 23,968,782 T22A probably damaging Het
Gm9931 T A 1: 147,281,853 noncoding transcript Het
Gpatch1 A T 7: 35,299,305 probably null Het
Gpr4 T C 7: 19,222,894 L247P probably damaging Het
Gtpbp3 G A 8: 71,491,114 E214K probably benign Het
Hdac7 G T 15: 97,811,587 Q21K probably damaging Het
Hivep3 A G 4: 119,872,050 probably benign Het
Hk2 C T 6: 82,739,650 M300I possibly damaging Het
Ighv1-61 T C 12: 115,359,279 Y71C probably damaging Het
Il1f8 T C 2: 24,154,618 V10A probably benign Het
Inpp5f G T 7: 128,663,987 S152I probably damaging Het
Jag1 C A 2: 137,096,309 W257L probably damaging Het
Jak2 T A 19: 29,294,915 N612K possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kbtbd6 A G 14: 79,452,606 D247G probably benign Het
Kif15 A G 9: 122,959,993 probably null Het
Kndc1 A G 7: 139,930,123 T1293A possibly damaging Het
Lpar5 T C 6: 125,082,207 I297T possibly damaging Het
Lpin2 T A 17: 71,232,143 probably benign Het
Mfsd4a A T 1: 132,053,571 L230Q probably damaging Het
Mmp8 T C 9: 7,565,549 V313A probably benign Het
Mrpl19 A T 6: 81,964,285 D98E probably damaging Het
Mybl1 A G 1: 9,690,115 I86T probably damaging Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Necab1 T C 4: 15,052,628 T117A probably damaging Het
Nol11 A G 11: 107,184,718 probably benign Het
Nucb2 G A 7: 116,540,027 probably null Het
Nupl1 G T 14: 60,251,215 P19T unknown Het
Odf2 T A 2: 29,904,034 L301Q probably damaging Het
Oit1 T C 14: 8,349,347 E201G probably benign Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr736 A G 14: 50,392,800 I15V probably benign Het
Oog4 T C 4: 143,438,875 Y234C probably benign Het
Papln T C 12: 83,777,208 probably null Het
Paqr6 C T 3: 88,365,929 A76V probably benign Het
Pclo A G 5: 14,676,480 probably benign Het
Pdzd8 T C 19: 59,345,311 T93A possibly damaging Het
Pkdrej A T 15: 85,821,167 Y189* probably null Het
Pknox2 A T 9: 36,923,638 N178K possibly damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plxnd1 A C 6: 115,958,620 L1735R probably damaging Het
Polm T A 11: 5,837,663 D30V possibly damaging Het
Rap1gap2 T A 11: 74,437,439 I100F probably damaging Het
Rasgef1c T A 11: 49,978,467 W414R probably benign Het
Rassf1 A G 9: 107,557,867 D187G probably benign Het
Rhag T C 17: 40,836,438 I397T probably benign Het
Rnft2 A G 5: 118,228,863 F269S probably damaging Het
Ror2 C T 13: 53,117,297 A329T probably benign Het
Slc4a1 T A 11: 102,356,258 N501I possibly damaging Het
Slc4a7 T A 14: 14,733,856 S89T probably damaging Het
Sptbn1 G A 11: 30,100,660 H2310Y probably benign Het
Tbc1d9b C A 11: 50,140,462 N103K probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tmem100 C T 11: 90,035,563 T72I probably damaging Het
Ttc38 A G 15: 85,852,963 T350A probably benign Het
Ubr4 C T 4: 139,450,529 T3241M probably damaging Het
Unc13d A T 11: 116,073,388 M350K possibly damaging Het
Vit T C 17: 78,625,114 I550T probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Zbtb12 T A 17: 34,896,401 H387Q possibly damaging Het
Other mutations in Rnmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02231:Rnmt APN 18 68314081 nonsense probably null
acre UTSW 18 68314034 missense probably damaging 1.00
talenti UTSW 18 68319214 missense probably damaging 0.98
IGL03098:Rnmt UTSW 18 68306002 missense probably damaging 0.98
R0137:Rnmt UTSW 18 68313700 missense probably benign 0.00
R0712:Rnmt UTSW 18 68307788 critical splice donor site probably null
R1493:Rnmt UTSW 18 68313707 missense probably damaging 1.00
R1541:Rnmt UTSW 18 68307782 missense probably damaging 1.00
R1606:Rnmt UTSW 18 68311653 missense possibly damaging 0.83
R2224:Rnmt UTSW 18 68305783 start gained probably benign
R3114:Rnmt UTSW 18 68314008 missense probably benign 0.13
R3115:Rnmt UTSW 18 68314008 missense probably benign 0.13
R4424:Rnmt UTSW 18 68311671 missense probably null 0.07
R4722:Rnmt UTSW 18 68305881 missense probably damaging 0.98
R4732:Rnmt UTSW 18 68317960 intron probably benign
R5173:Rnmt UTSW 18 68321359 utr 3 prime probably benign
R5523:Rnmt UTSW 18 68313702 missense probably benign
R5579:Rnmt UTSW 18 68306115 missense possibly damaging 0.93
R5966:Rnmt UTSW 18 68311618 missense probably benign 0.16
R6322:Rnmt UTSW 18 68319214 missense probably damaging 0.98
R7149:Rnmt UTSW 18 68319151 missense probably damaging 1.00
R7529:Rnmt UTSW 18 68311655 missense probably benign 0.41
R7620:Rnmt UTSW 18 68314034 missense probably damaging 1.00
R8071:Rnmt UTSW 18 68307652 missense probably benign 0.03
Z1088:Rnmt UTSW 18 68307674 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CATGCATGATATGATTGACAGGATG -3'
(R):5'- CTACCGTGATCAAAGCCGTTG -3'

Sequencing Primer
(F):5'- AGAAGACGCCTTGAAGCT -3'
(R):5'- GTTGGCTCCCTTCCCTTAGG -3'
Posted On2015-10-21