Incidental Mutation 'R4706:Nr4a2'
ID355191
Institutional Source Beutler Lab
Gene Symbol Nr4a2
Ensembl Gene ENSMUSG00000026826
Gene Namenuclear receptor subfamily 4, group A, member 2
SynonymsRNR-1, HZF-3, Nurr1
MMRRC Submission 041954-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4706 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location57106830-57124003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 57112213 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 13 (P13H)
Ref Sequence ENSEMBL: ENSMUSP00000108246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028166] [ENSMUST00000112627] [ENSMUST00000112629] [ENSMUST00000183542]
Predicted Effect probably damaging
Transcript: ENSMUST00000028166
AA Change: P76H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028166
Gene: ENSMUSG00000026826
AA Change: P76H

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 124 134 N/A INTRINSIC
ZnF_C4 260 331 2.45e-39 SMART
low complexity region 346 363 N/A INTRINSIC
HOLI 408 566 1.03e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112627
AA Change: P13H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108246
Gene: ENSMUSG00000026826
AA Change: P13H

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
ZnF_C4 197 268 2.45e-39 SMART
low complexity region 283 300 N/A INTRINSIC
HOLI 345 503 1.03e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112629
AA Change: P76H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108248
Gene: ENSMUSG00000026826
AA Change: P76H

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 124 134 N/A INTRINSIC
ZnF_C4 260 331 2.45e-39 SMART
low complexity region 346 363 N/A INTRINSIC
HOLI 408 566 1.03e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140165
Predicted Effect probably damaging
Transcript: ENSMUST00000183542
AA Change: P13H

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138824
Gene: ENSMUSG00000026826
AA Change: P13H

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
ZnF_C4 197 268 2.45e-39 SMART
low complexity region 283 300 N/A INTRINSIC
Pfam:Hormone_recep 322 392 9.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. The encoded protein may act as a transcription factor. Mutations in this gene have been associated with disorders related to dopaminergic dysfunction, including Parkinson disease, schizophernia, and manic depression. Misregulation of this gene may be associated with rheumatoid arthritis. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene fail to develop dopaminergic neurons in the mesencephalon and die within the first 12 hours of life. Heterozygotes suffer from reduced motor performance in old age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,279 M353K probably benign Het
Abca16 T A 7: 120,465,765 N548K probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Afap1l2 A T 19: 56,937,240 I152N possibly damaging Het
Ankrd52 T G 10: 128,378,161 M62R probably benign Het
Aox4 A T 1: 58,266,787 T1317S probably damaging Het
Apol7c T A 15: 77,525,723 Q341L probably benign Het
Arhgef4 C T 1: 34,732,217 R1202W probably benign Het
B4galnt2 C T 11: 95,876,097 probably null Het
BC049762 A T 11: 51,253,841 F204L possibly damaging Het
Cecr2 A T 6: 120,755,578 E477V possibly damaging Het
Chmp7 A T 14: 69,718,561 D419E probably benign Het
Cmip A C 8: 117,377,154 K127T probably damaging Het
Csmd2 T C 4: 128,544,751 V3041A probably benign Het
Cyp1b1 T A 17: 79,713,342 I324F possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Ddx10 T C 9: 53,233,931 T249A probably damaging Het
Dscaml1 T C 9: 45,450,580 Y213H probably damaging Het
Eef1a2 T C 2: 181,155,357 D17G probably damaging Het
Fbn1 T C 2: 125,370,149 I848V probably benign Het
Fbxw18 A G 9: 109,690,517 I307T probably benign Het
Fxr1 T A 3: 34,064,129 D500E probably damaging Het
Gars G A 6: 55,069,378 G492D probably damaging Het
Gria2 A T 3: 80,740,990 D146E probably benign Het
Gstz1 A G 12: 87,159,120 N37S probably benign Het
Hnrnph3 C A 10: 63,017,280 G194V probably damaging Het
Il2rb T C 15: 78,486,400 R172G possibly damaging Het
Itga11 T A 9: 62,755,296 V517D possibly damaging Het
Kcnq4 A G 4: 120,704,486 I462T probably benign Het
Klf6 T A 13: 5,861,640 M1K probably null Het
Lrp8 G A 4: 107,861,273 A817T probably benign Het
Map3k5 T A 10: 20,058,938 Y509N probably damaging Het
Mdc1 C T 17: 35,852,779 S1073F probably damaging Het
Mme A G 3: 63,348,712 D531G possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 A T 4: 106,691,624 V1014E possibly damaging Het
Myo1d C T 11: 80,666,641 C491Y probably damaging Het
Ncoa3 C A 2: 166,047,879 D61E probably damaging Het
Nmrk1 A G 19: 18,645,127 E190G probably benign Het
Nup205 T C 6: 35,202,008 L671P probably damaging Het
Olfr1058 G A 2: 86,386,388 T10I probably benign Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr429 A G 1: 174,089,702 I221V probably damaging Het
Olfr568 T A 7: 102,877,433 H104Q probably damaging Het
Omt2a T C 9: 78,313,070 I16V probably benign Het
Osbpl9 A T 4: 109,156,687 I70N probably damaging Het
Pclo A T 5: 14,714,207 L4231F unknown Het
Per1 C T 11: 69,100,618 probably benign Het
Perm1 G T 4: 156,217,074 C25F probably damaging Het
Phf3 A G 1: 30,805,606 V1424A probably damaging Het
Plxnb1 T G 9: 109,112,028 L1625R probably damaging Het
Ppid G A 3: 79,599,052 V216I probably benign Het
Ppp4r3a C T 12: 101,041,916 G754D probably damaging Het
Prex2 G T 1: 11,199,988 W1299L probably damaging Het
Ptprn2 C A 12: 116,872,094 Q350K probably benign Het
Ralyl G A 3: 14,039,790 probably null Het
Rbm8a G A 3: 96,630,052 probably benign Het
Ros1 A G 10: 52,101,894 S1419P possibly damaging Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Rtel1 T C 2: 181,323,746 probably null Het
Sacs A G 14: 61,204,273 E1256G probably damaging Het
Sec23a A G 12: 58,982,586 V467A probably damaging Het
Sec24d T A 3: 123,355,778 N811K possibly damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shisa5 T A 9: 109,056,060 C133S probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a31 G A 3: 40,716,545 A89T probably damaging Het
Slc6a1 G T 6: 114,307,752 R257L possibly damaging Het
Sntb1 C T 15: 55,749,274 V303M probably benign Het
Snx20 A G 8: 88,627,811 V97A probably damaging Het
Vmn1r29 T A 6: 58,308,151 N285K probably benign Het
Vmn2r98 T G 17: 19,069,745 S514R probably damaging Het
Zfp28 A T 7: 6,389,794 E156D probably damaging Het
Zfp39 A G 11: 58,902,807 V35A probably benign Het
Zfp536 A C 7: 37,569,466 I175S probably damaging Het
Zic5 A T 14: 122,459,557 S549T unknown Het
Other mutations in Nr4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Nr4a2 APN 2 57109217 missense probably damaging 1.00
IGL01148:Nr4a2 APN 2 57111971 missense probably benign 0.00
IGL01395:Nr4a2 APN 2 57112153 missense probably damaging 0.98
IGL02123:Nr4a2 APN 2 57111655 missense possibly damaging 0.95
IGL02311:Nr4a2 APN 2 57111731 missense probably benign
IGL02698:Nr4a2 APN 2 57108160 missense probably damaging 1.00
IGL03178:Nr4a2 APN 2 57110766 missense probably damaging 1.00
IGL03261:Nr4a2 APN 2 57110187 missense probably benign 0.40
R0025:Nr4a2 UTSW 2 57108615 missense probably benign 0.14
R0078:Nr4a2 UTSW 2 57112228 missense probably damaging 1.00
R1138:Nr4a2 UTSW 2 57112379 missense probably damaging 0.96
R1222:Nr4a2 UTSW 2 57108324 missense probably damaging 0.97
R1418:Nr4a2 UTSW 2 57108324 missense probably damaging 0.97
R1755:Nr4a2 UTSW 2 57109092 missense probably damaging 1.00
R2265:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2266:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2267:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2281:Nr4a2 UTSW 2 57112199 missense probably benign 0.00
R4191:Nr4a2 UTSW 2 57112379 missense probably damaging 0.96
R4707:Nr4a2 UTSW 2 57112093 missense probably benign 0.17
R4745:Nr4a2 UTSW 2 57110151 missense probably damaging 1.00
R4924:Nr4a2 UTSW 2 57112023 missense probably benign 0.00
R5350:Nr4a2 UTSW 2 57111865 missense probably damaging 0.98
R5495:Nr4a2 UTSW 2 57112375 missense probably damaging 1.00
R6139:Nr4a2 UTSW 2 57108689 missense probably damaging 0.98
R6156:Nr4a2 UTSW 2 57112352 missense probably damaging 1.00
R6325:Nr4a2 UTSW 2 57112418 missense probably damaging 1.00
R6674:Nr4a2 UTSW 2 57112424 missense probably damaging 1.00
R6786:Nr4a2 UTSW 2 57111908 missense probably benign 0.29
R6968:Nr4a2 UTSW 2 57108746 splice site probably null
R7135:Nr4a2 UTSW 2 57112249 missense possibly damaging 0.80
R7256:Nr4a2 UTSW 2 57112369 missense probably damaging 1.00
R7495:Nr4a2 UTSW 2 57112159 missense possibly damaging 0.89
R7596:Nr4a2 UTSW 2 57108231 missense probably damaging 1.00
R7733:Nr4a2 UTSW 2 57112321 missense probably benign 0.01
Z1088:Nr4a2 UTSW 2 57111614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACGTAGTTCTGGTGGAAG -3'
(R):5'- CGCTTCTCAGAGCTACAGTTAC -3'

Sequencing Primer
(F):5'- TATGCTGCACCTGGAAGCTC -3'
(R):5'- ACAGTTACCACTCTTCGGGAG -3'
Posted On2015-10-21