Incidental Mutation 'R4706:Mme'
ID355201
Institutional Source Beutler Lab
Gene Symbol Mme
Ensembl Gene ENSMUSG00000027820
Gene Namemembrane metallo endopeptidase
SynonymsCD10, neprilysin, NEP, neutral endopeptidase, 6030454K05Rik
MMRRC Submission 041954-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4706 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location63241537-63386030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63348712 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 531 (D531G)
Ref Sequence ENSEMBL: ENSMUSP00000141544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000194134] [ENSMUST00000194150]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029400
AA Change: D531G

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: D531G

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.7e-103 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 5.8e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193805
Predicted Effect possibly damaging
Transcript: ENSMUST00000194134
AA Change: D531G

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: D531G

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000194150
AA Change: D531G

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: D531G

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,279 M353K probably benign Het
Abca16 T A 7: 120,465,765 N548K probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Afap1l2 A T 19: 56,937,240 I152N possibly damaging Het
Ankrd52 T G 10: 128,378,161 M62R probably benign Het
Aox4 A T 1: 58,266,787 T1317S probably damaging Het
Apol7c T A 15: 77,525,723 Q341L probably benign Het
Arhgef4 C T 1: 34,732,217 R1202W probably benign Het
B4galnt2 C T 11: 95,876,097 probably null Het
BC049762 A T 11: 51,253,841 F204L possibly damaging Het
Cecr2 A T 6: 120,755,578 E477V possibly damaging Het
Chmp7 A T 14: 69,718,561 D419E probably benign Het
Cmip A C 8: 117,377,154 K127T probably damaging Het
Csmd2 T C 4: 128,544,751 V3041A probably benign Het
Cyp1b1 T A 17: 79,713,342 I324F possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Ddx10 T C 9: 53,233,931 T249A probably damaging Het
Dscaml1 T C 9: 45,450,580 Y213H probably damaging Het
Eef1a2 T C 2: 181,155,357 D17G probably damaging Het
Fbn1 T C 2: 125,370,149 I848V probably benign Het
Fbxw18 A G 9: 109,690,517 I307T probably benign Het
Fxr1 T A 3: 34,064,129 D500E probably damaging Het
Gars G A 6: 55,069,378 G492D probably damaging Het
Gria2 A T 3: 80,740,990 D146E probably benign Het
Gstz1 A G 12: 87,159,120 N37S probably benign Het
Hnrnph3 C A 10: 63,017,280 G194V probably damaging Het
Il2rb T C 15: 78,486,400 R172G possibly damaging Het
Itga11 T A 9: 62,755,296 V517D possibly damaging Het
Kcnq4 A G 4: 120,704,486 I462T probably benign Het
Klf6 T A 13: 5,861,640 M1K probably null Het
Lrp8 G A 4: 107,861,273 A817T probably benign Het
Map3k5 T A 10: 20,058,938 Y509N probably damaging Het
Mdc1 C T 17: 35,852,779 S1073F probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 A T 4: 106,691,624 V1014E possibly damaging Het
Myo1d C T 11: 80,666,641 C491Y probably damaging Het
Ncoa3 C A 2: 166,047,879 D61E probably damaging Het
Nmrk1 A G 19: 18,645,127 E190G probably benign Het
Nr4a2 G T 2: 57,112,213 P13H probably damaging Het
Nup205 T C 6: 35,202,008 L671P probably damaging Het
Olfr1058 G A 2: 86,386,388 T10I probably benign Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr429 A G 1: 174,089,702 I221V probably damaging Het
Olfr568 T A 7: 102,877,433 H104Q probably damaging Het
Omt2a T C 9: 78,313,070 I16V probably benign Het
Osbpl9 A T 4: 109,156,687 I70N probably damaging Het
Pclo A T 5: 14,714,207 L4231F unknown Het
Per1 C T 11: 69,100,618 probably benign Het
Perm1 G T 4: 156,217,074 C25F probably damaging Het
Phf3 A G 1: 30,805,606 V1424A probably damaging Het
Plxnb1 T G 9: 109,112,028 L1625R probably damaging Het
Ppid G A 3: 79,599,052 V216I probably benign Het
Ppp4r3a C T 12: 101,041,916 G754D probably damaging Het
Prex2 G T 1: 11,199,988 W1299L probably damaging Het
Ptprn2 C A 12: 116,872,094 Q350K probably benign Het
Ralyl G A 3: 14,039,790 probably null Het
Rbm8a G A 3: 96,630,052 probably benign Het
Ros1 A G 10: 52,101,894 S1419P possibly damaging Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Rtel1 T C 2: 181,323,746 probably null Het
Sacs A G 14: 61,204,273 E1256G probably damaging Het
Sec23a A G 12: 58,982,586 V467A probably damaging Het
Sec24d T A 3: 123,355,778 N811K possibly damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shisa5 T A 9: 109,056,060 C133S probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a31 G A 3: 40,716,545 A89T probably damaging Het
Slc6a1 G T 6: 114,307,752 R257L possibly damaging Het
Sntb1 C T 15: 55,749,274 V303M probably benign Het
Snx20 A G 8: 88,627,811 V97A probably damaging Het
Vmn1r29 T A 6: 58,308,151 N285K probably benign Het
Vmn2r98 T G 17: 19,069,745 S514R probably damaging Het
Zfp28 A T 7: 6,389,794 E156D probably damaging Het
Zfp39 A G 11: 58,902,807 V35A probably benign Het
Zfp536 A C 7: 37,569,466 I175S probably damaging Het
Zic5 A T 14: 122,459,557 S549T unknown Het
Other mutations in Mme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mme APN 3 63340044 missense possibly damaging 0.95
IGL00329:Mme APN 3 63380328 nonsense probably null
IGL01013:Mme APN 3 63327860 unclassified probably null
IGL01316:Mme APN 3 63340159 splice site probably benign
IGL01333:Mme APN 3 63346091 missense probably damaging 1.00
IGL01392:Mme APN 3 63362046 missense probably damaging 1.00
IGL01566:Mme APN 3 63361929 splice site probably benign
IGL01739:Mme APN 3 63340113 missense possibly damaging 0.78
IGL01996:Mme APN 3 63343549 missense probably benign 0.11
IGL02125:Mme APN 3 63348649 missense probably damaging 1.00
IGL02154:Mme APN 3 63343555 missense probably benign
IGL03214:Mme APN 3 63329690 missense possibly damaging 0.72
IGL03291:Mme APN 3 63346104 missense probably benign 0.00
R0498:Mme UTSW 3 63346066 missense probably damaging 1.00
R0595:Mme UTSW 3 63328181 missense probably benign 0.27
R0980:Mme UTSW 3 63340129 missense probably benign
R1210:Mme UTSW 3 63343606 missense probably benign 0.01
R1600:Mme UTSW 3 63365058 missense probably damaging 1.00
R1852:Mme UTSW 3 63327983 missense probably benign 0.31
R1852:Mme UTSW 3 63328046 missense probably benign 0.00
R2037:Mme UTSW 3 63328260 missense probably null 1.00
R2177:Mme UTSW 3 63301005 missense probably benign 0.02
R2200:Mme UTSW 3 63380292 missense possibly damaging 0.87
R2306:Mme UTSW 3 63300252 missense probably benign 0.00
R2847:Mme UTSW 3 63345199 missense possibly damaging 0.91
R3008:Mme UTSW 3 63358957 missense probably damaging 1.00
R3749:Mme UTSW 3 63343540 missense probably damaging 1.00
R3876:Mme UTSW 3 63362059 splice site probably benign
R3961:Mme UTSW 3 63345192 missense probably damaging 1.00
R3981:Mme UTSW 3 63328064 missense probably damaging 1.00
R3982:Mme UTSW 3 63328064 missense probably damaging 1.00
R3983:Mme UTSW 3 63328064 missense probably damaging 1.00
R4494:Mme UTSW 3 63347192 missense probably benign
R4589:Mme UTSW 3 63380272 missense probably benign
R4871:Mme UTSW 3 63340032 missense probably benign 0.01
R4957:Mme UTSW 3 63343489 splice site probably benign
R5053:Mme UTSW 3 63364849 missense probably damaging 1.00
R5316:Mme UTSW 3 63368954 missense probably damaging 1.00
R5502:Mme UTSW 3 63300281 nonsense probably null
R5579:Mme UTSW 3 63348645 missense probably damaging 1.00
R6007:Mme UTSW 3 63343508 nonsense probably null
R6022:Mme UTSW 3 63364797 missense probably damaging 1.00
R6143:Mme UTSW 3 63300111 splice site probably null
R6154:Mme UTSW 3 63300253 missense probably damaging 0.98
R6333:Mme UTSW 3 63341961 missense probably benign 0.00
R6476:Mme UTSW 3 63343635 critical splice donor site probably null
R6514:Mme UTSW 3 63364844 nonsense probably null
R6711:Mme UTSW 3 63341918 missense possibly damaging 0.93
R6842:Mme UTSW 3 63362044 missense probably damaging 1.00
R6996:Mme UTSW 3 63346102 missense possibly damaging 0.63
R7040:Mme UTSW 3 63368923 missense probably damaging 1.00
R7043:Mme UTSW 3 63345217 nonsense probably null
R7084:Mme UTSW 3 63328217 missense probably damaging 0.98
R7126:Mme UTSW 3 63368901 missense probably damaging 0.97
R7783:Mme UTSW 3 63364867 missense probably damaging 1.00
X0058:Mme UTSW 3 63365021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTAATAAAACAAGCATCCTCTG -3'
(R):5'- GCTTAGTGGAGAAAGGCATTCAC -3'

Sequencing Primer
(F):5'- GCTGCTTCTTAACAGGATTAACTTG -3'
(R):5'- AGGCATTCACTGGAAGTTCC -3'
Posted On2015-10-21