Incidental Mutation 'R4706:Kcnq4'
ID355208
Institutional Source Beutler Lab
Gene Symbol Kcnq4
Ensembl Gene ENSMUSG00000028631
Gene Namepotassium voltage-gated channel, subfamily Q, member 4
Synonyms
MMRRC Submission 041954-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R4706 (G1)
Quality Score192
Status Not validated
Chromosome4
Chromosomal Location120696138-120748612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120704486 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 462 (I462T)
Ref Sequence ENSEMBL: ENSMUSP00000030376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030376]
Predicted Effect probably benign
Transcript: ENSMUST00000030376
AA Change: I462T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030376
Gene: ENSMUSG00000028631
AA Change: I462T

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 36 77 N/A INTRINSIC
Pfam:Ion_trans 99 331 1.2e-28 PFAM
Pfam:Ion_trans_2 244 324 5.4e-16 PFAM
Pfam:KCNQ_channel 465 655 1.6e-93 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a potassium channel that is thought to play a critical role in the regulation of neuronal excitability, particularly in sensory cells of the cochlea. The current generated by this channel is inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. The encoded protein can form a homomultimeric potassium channel or possibly a heteromultimeric channel in association with the protein encoded by the KCNQ3 gene. Defects in this gene are a cause of nonsyndromic sensorineural deafness type 2 (DFNA2), an autosomal dominant form of progressive hearing loss. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either homozygous for a knock-out allele or homozygous for a dominant negative knock-in allele exhibit a slowly progressive hearing loss due to chronic depolarization and subsequent degeneration of cochlear outer hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,279 M353K probably benign Het
Abca16 T A 7: 120,465,765 N548K probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Afap1l2 A T 19: 56,937,240 I152N possibly damaging Het
Ankrd52 T G 10: 128,378,161 M62R probably benign Het
Aox4 A T 1: 58,266,787 T1317S probably damaging Het
Apol7c T A 15: 77,525,723 Q341L probably benign Het
Arhgef4 C T 1: 34,732,217 R1202W probably benign Het
B4galnt2 C T 11: 95,876,097 probably null Het
BC049762 A T 11: 51,253,841 F204L possibly damaging Het
Cecr2 A T 6: 120,755,578 E477V possibly damaging Het
Chmp7 A T 14: 69,718,561 D419E probably benign Het
Cmip A C 8: 117,377,154 K127T probably damaging Het
Csmd2 T C 4: 128,544,751 V3041A probably benign Het
Cyp1b1 T A 17: 79,713,342 I324F possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Ddx10 T C 9: 53,233,931 T249A probably damaging Het
Dscaml1 T C 9: 45,450,580 Y213H probably damaging Het
Eef1a2 T C 2: 181,155,357 D17G probably damaging Het
Fbn1 T C 2: 125,370,149 I848V probably benign Het
Fbxw18 A G 9: 109,690,517 I307T probably benign Het
Fxr1 T A 3: 34,064,129 D500E probably damaging Het
Gars G A 6: 55,069,378 G492D probably damaging Het
Gria2 A T 3: 80,740,990 D146E probably benign Het
Gstz1 A G 12: 87,159,120 N37S probably benign Het
Hnrnph3 C A 10: 63,017,280 G194V probably damaging Het
Il2rb T C 15: 78,486,400 R172G possibly damaging Het
Itga11 T A 9: 62,755,296 V517D possibly damaging Het
Klf6 T A 13: 5,861,640 M1K probably null Het
Lrp8 G A 4: 107,861,273 A817T probably benign Het
Map3k5 T A 10: 20,058,938 Y509N probably damaging Het
Mdc1 C T 17: 35,852,779 S1073F probably damaging Het
Mme A G 3: 63,348,712 D531G possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 A T 4: 106,691,624 V1014E possibly damaging Het
Myo1d C T 11: 80,666,641 C491Y probably damaging Het
Ncoa3 C A 2: 166,047,879 D61E probably damaging Het
Nmrk1 A G 19: 18,645,127 E190G probably benign Het
Nr4a2 G T 2: 57,112,213 P13H probably damaging Het
Nup205 T C 6: 35,202,008 L671P probably damaging Het
Olfr1058 G A 2: 86,386,388 T10I probably benign Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr429 A G 1: 174,089,702 I221V probably damaging Het
Olfr568 T A 7: 102,877,433 H104Q probably damaging Het
Omt2a T C 9: 78,313,070 I16V probably benign Het
Osbpl9 A T 4: 109,156,687 I70N probably damaging Het
Pclo A T 5: 14,714,207 L4231F unknown Het
Per1 C T 11: 69,100,618 probably benign Het
Perm1 G T 4: 156,217,074 C25F probably damaging Het
Phf3 A G 1: 30,805,606 V1424A probably damaging Het
Plxnb1 T G 9: 109,112,028 L1625R probably damaging Het
Ppid G A 3: 79,599,052 V216I probably benign Het
Ppp4r3a C T 12: 101,041,916 G754D probably damaging Het
Prex2 G T 1: 11,199,988 W1299L probably damaging Het
Ptprn2 C A 12: 116,872,094 Q350K probably benign Het
Ralyl G A 3: 14,039,790 probably null Het
Rbm8a G A 3: 96,630,052 probably benign Het
Ros1 A G 10: 52,101,894 S1419P possibly damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Rtel1 T C 2: 181,323,746 probably null Het
Sacs A G 14: 61,204,273 E1256G probably damaging Het
Sec23a A G 12: 58,982,586 V467A probably damaging Het
Sec24d T A 3: 123,355,778 N811K possibly damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shisa5 T A 9: 109,056,060 C133S probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a31 G A 3: 40,716,545 A89T probably damaging Het
Slc6a1 G T 6: 114,307,752 R257L possibly damaging Het
Sntb1 C T 15: 55,749,274 V303M probably benign Het
Snx20 A G 8: 88,627,811 V97A probably damaging Het
Vmn1r29 T A 6: 58,308,151 N285K probably benign Het
Vmn2r98 T G 17: 19,069,745 S514R probably damaging Het
Zfp28 A T 7: 6,389,794 E156D probably damaging Het
Zfp39 A G 11: 58,902,807 V35A probably benign Het
Zfp536 A C 7: 37,569,466 I175S probably damaging Het
Zic5 A T 14: 122,459,557 S549T unknown Het
Other mutations in Kcnq4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcnq4 APN 4 120698016 nonsense probably null
IGL00225:Kcnq4 APN 4 120698016 nonsense probably null
IGL00228:Kcnq4 APN 4 120698016 nonsense probably null
IGL00310:Kcnq4 APN 4 120698016 nonsense probably null
IGL00330:Kcnq4 APN 4 120698016 nonsense probably null
IGL00333:Kcnq4 APN 4 120698016 nonsense probably null
IGL00335:Kcnq4 APN 4 120698016 nonsense probably null
IGL00336:Kcnq4 APN 4 120698016 nonsense probably null
IGL01143:Kcnq4 APN 4 120698623 missense probably damaging 1.00
IGL01373:Kcnq4 APN 4 120717032 missense probably damaging 1.00
IGL02095:Kcnq4 APN 4 120700027 splice site probably benign
IGL02335:Kcnq4 APN 4 120715854 missense probably damaging 1.00
IGL03188:Kcnq4 APN 4 120704426 missense possibly damaging 0.81
R0045:Kcnq4 UTSW 4 120697955 missense probably damaging 0.99
R0045:Kcnq4 UTSW 4 120697955 missense probably damaging 0.99
R0423:Kcnq4 UTSW 4 120717508 missense probably damaging 1.00
R0483:Kcnq4 UTSW 4 120716601 missense probably damaging 1.00
R0837:Kcnq4 UTSW 4 120746861 missense probably benign 0.00
R1722:Kcnq4 UTSW 4 120702427 missense probably benign 0.00
R1826:Kcnq4 UTSW 4 120704504 missense probably benign 0.00
R2059:Kcnq4 UTSW 4 120698002 missense probably benign 0.00
R4327:Kcnq4 UTSW 4 120711364 missense probably benign 0.00
R4690:Kcnq4 UTSW 4 120717011 missense probably damaging 0.99
R4729:Kcnq4 UTSW 4 120713074 missense possibly damaging 0.47
R4806:Kcnq4 UTSW 4 120713094 missense probably damaging 1.00
R4859:Kcnq4 UTSW 4 120716613 missense probably damaging 1.00
R4885:Kcnq4 UTSW 4 120713063 missense probably benign 0.01
R5073:Kcnq4 UTSW 4 120717517 missense probably damaging 1.00
R5517:Kcnq4 UTSW 4 120715809 missense possibly damaging 0.66
R5590:Kcnq4 UTSW 4 120715885 missense probably damaging 0.98
R5653:Kcnq4 UTSW 4 120702411 missense probably benign 0.00
R5750:Kcnq4 UTSW 4 120715049 missense probably damaging 1.00
R6141:Kcnq4 UTSW 4 120715869 missense probably damaging 1.00
R6160:Kcnq4 UTSW 4 120716559 missense probably damaging 1.00
R7087:Kcnq4 UTSW 4 120704399 missense probably damaging 0.96
R7088:Kcnq4 UTSW 4 120704399 missense probably damaging 0.96
R7143:Kcnq4 UTSW 4 120711239 missense probably benign 0.05
R7225:Kcnq4 UTSW 4 120746914 missense probably benign 0.03
R7479:Kcnq4 UTSW 4 120715825 missense probably damaging 0.98
R7574:Kcnq4 UTSW 4 120711368 missense probably benign
R7879:Kcnq4 UTSW 4 120702435 missense probably benign 0.13
R7962:Kcnq4 UTSW 4 120702435 missense probably benign 0.13
X0020:Kcnq4 UTSW 4 120715327 missense probably damaging 1.00
Z1176:Kcnq4 UTSW 4 120698497 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTCTAGAGCAGACAATCCAAGC -3'
(R):5'- TGATGGAAACCAAGACCCAG -3'

Sequencing Primer
(F):5'- TACCCAAGCTGCCTCTAGC -3'
(R):5'- GTAGCAGCCCCCTAGATCATCTAG -3'
Posted On2015-10-21