Incidental Mutation 'R4706:Slc6a1'
ID355219
Institutional Source Beutler Lab
Gene Symbol Slc6a1
Ensembl Gene ENSMUSG00000030310
Gene Namesolute carrier family 6 (neurotransmitter transporter, GABA), member 1
SynonymsGat1, XT-1, Xtrp1, GAT-1, Gabt1, Gabt
MMRRC Submission 041954-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R4706 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location114282635-114317532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114307752 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 257 (R257L)
Ref Sequence ENSEMBL: ENSMUSP00000032454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032454] [ENSMUST00000204074]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032454
AA Change: R257L

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032454
Gene: ENSMUSG00000030310
AA Change: R257L

DomainStartEndE-ValueType
Pfam:SNF 44 559 6.1e-235 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204074
AA Change: R73L

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145080
Gene: ENSMUSG00000030310
AA Change: R73L

DomainStartEndE-ValueType
Pfam:SNF 1 375 1.2e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204600
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a gamma-aminobutyric acid (GABA) transporter that localizes to the plasma membrane. The encoded protein removes GABA from the synaptic cleft, restoring it to presynaptic terminals. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous hypomorphic mice display abnormal inhibitory postsynaptic currents, and abnormal GABA uptake and release. Null mice show hyperactivity and various behavioral abnormalities, as well as an aversion to bitter taste. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,279 M353K probably benign Het
Abca16 T A 7: 120,465,765 N548K probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Afap1l2 A T 19: 56,937,240 I152N possibly damaging Het
Ankrd52 T G 10: 128,378,161 M62R probably benign Het
Aox4 A T 1: 58,266,787 T1317S probably damaging Het
Apol7c T A 15: 77,525,723 Q341L probably benign Het
Arhgef4 C T 1: 34,732,217 R1202W probably benign Het
B4galnt2 C T 11: 95,876,097 probably null Het
BC049762 A T 11: 51,253,841 F204L possibly damaging Het
Cecr2 A T 6: 120,755,578 E477V possibly damaging Het
Chmp7 A T 14: 69,718,561 D419E probably benign Het
Cmip A C 8: 117,377,154 K127T probably damaging Het
Csmd2 T C 4: 128,544,751 V3041A probably benign Het
Cyp1b1 T A 17: 79,713,342 I324F possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Ddx10 T C 9: 53,233,931 T249A probably damaging Het
Dscaml1 T C 9: 45,450,580 Y213H probably damaging Het
Eef1a2 T C 2: 181,155,357 D17G probably damaging Het
Fbn1 T C 2: 125,370,149 I848V probably benign Het
Fbxw18 A G 9: 109,690,517 I307T probably benign Het
Fxr1 T A 3: 34,064,129 D500E probably damaging Het
Gars G A 6: 55,069,378 G492D probably damaging Het
Gria2 A T 3: 80,740,990 D146E probably benign Het
Gstz1 A G 12: 87,159,120 N37S probably benign Het
Hnrnph3 C A 10: 63,017,280 G194V probably damaging Het
Il2rb T C 15: 78,486,400 R172G possibly damaging Het
Itga11 T A 9: 62,755,296 V517D possibly damaging Het
Kcnq4 A G 4: 120,704,486 I462T probably benign Het
Klf6 T A 13: 5,861,640 M1K probably null Het
Lrp8 G A 4: 107,861,273 A817T probably benign Het
Map3k5 T A 10: 20,058,938 Y509N probably damaging Het
Mdc1 C T 17: 35,852,779 S1073F probably damaging Het
Mme A G 3: 63,348,712 D531G possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 A T 4: 106,691,624 V1014E possibly damaging Het
Myo1d C T 11: 80,666,641 C491Y probably damaging Het
Ncoa3 C A 2: 166,047,879 D61E probably damaging Het
Nmrk1 A G 19: 18,645,127 E190G probably benign Het
Nr4a2 G T 2: 57,112,213 P13H probably damaging Het
Nup205 T C 6: 35,202,008 L671P probably damaging Het
Olfr1058 G A 2: 86,386,388 T10I probably benign Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr429 A G 1: 174,089,702 I221V probably damaging Het
Olfr568 T A 7: 102,877,433 H104Q probably damaging Het
Omt2a T C 9: 78,313,070 I16V probably benign Het
Osbpl9 A T 4: 109,156,687 I70N probably damaging Het
Pclo A T 5: 14,714,207 L4231F unknown Het
Per1 C T 11: 69,100,618 probably benign Het
Perm1 G T 4: 156,217,074 C25F probably damaging Het
Phf3 A G 1: 30,805,606 V1424A probably damaging Het
Plxnb1 T G 9: 109,112,028 L1625R probably damaging Het
Ppid G A 3: 79,599,052 V216I probably benign Het
Ppp4r3a C T 12: 101,041,916 G754D probably damaging Het
Prex2 G T 1: 11,199,988 W1299L probably damaging Het
Ptprn2 C A 12: 116,872,094 Q350K probably benign Het
Ralyl G A 3: 14,039,790 probably null Het
Rbm8a G A 3: 96,630,052 probably benign Het
Ros1 A G 10: 52,101,894 S1419P possibly damaging Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Rtel1 T C 2: 181,323,746 probably null Het
Sacs A G 14: 61,204,273 E1256G probably damaging Het
Sec23a A G 12: 58,982,586 V467A probably damaging Het
Sec24d T A 3: 123,355,778 N811K possibly damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shisa5 T A 9: 109,056,060 C133S probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a31 G A 3: 40,716,545 A89T probably damaging Het
Sntb1 C T 15: 55,749,274 V303M probably benign Het
Snx20 A G 8: 88,627,811 V97A probably damaging Het
Vmn1r29 T A 6: 58,308,151 N285K probably benign Het
Vmn2r98 T G 17: 19,069,745 S514R probably damaging Het
Zfp28 A T 7: 6,389,794 E156D probably damaging Het
Zfp39 A G 11: 58,902,807 V35A probably benign Het
Zfp536 A C 7: 37,569,466 I175S probably damaging Het
Zic5 A T 14: 122,459,557 S549T unknown Het
Other mutations in Slc6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Slc6a1 APN 6 114314465 splice site probably null
IGL01604:Slc6a1 APN 6 114314401 missense probably damaging 1.00
IGL02004:Slc6a1 APN 6 114314325 missense probably benign 0.35
IGL02437:Slc6a1 APN 6 114308617 missense probably damaging 1.00
IGL02553:Slc6a1 APN 6 114302490 intron probably benign
lewis UTSW 6 114307770 missense probably damaging 1.00
R0178:Slc6a1 UTSW 6 114304852 missense possibly damaging 0.82
R0238:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R0238:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R0239:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R0239:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R0408:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R1165:Slc6a1 UTSW 6 114311829 missense probably damaging 1.00
R1451:Slc6a1 UTSW 6 114307795 nonsense probably null
R1535:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R1568:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R1900:Slc6a1 UTSW 6 114311854 missense possibly damaging 0.50
R2011:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R2134:Slc6a1 UTSW 6 114302016 missense probably benign
R2139:Slc6a1 UTSW 6 114304061 missense possibly damaging 0.77
R2152:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R2154:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R2207:Slc6a1 UTSW 6 114308671 missense probably damaging 1.00
R4627:Slc6a1 UTSW 6 114308106 missense probably benign
R4690:Slc6a1 UTSW 6 114302831 missense probably damaging 0.99
R4886:Slc6a1 UTSW 6 114302533 missense possibly damaging 0.94
R4974:Slc6a1 UTSW 6 114307701 missense probably damaging 0.97
R5219:Slc6a1 UTSW 6 114310221 missense probably benign 0.18
R5354:Slc6a1 UTSW 6 114302623 missense possibly damaging 0.46
R5361:Slc6a1 UTSW 6 114302532 missense probably benign 0.00
R6448:Slc6a1 UTSW 6 114302086 missense possibly damaging 0.82
R6678:Slc6a1 UTSW 6 114307776 missense probably benign 0.00
R6941:Slc6a1 UTSW 6 114313512 nonsense probably null
R7347:Slc6a1 UTSW 6 114311818 missense probably damaging 0.99
R7811:Slc6a1 UTSW 6 114302554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCCTTGCCTGGCCAAAG -3'
(R):5'- ACCTGCTCAGATACCTAGTGC -3'

Sequencing Primer
(F):5'- TTGCCTGGCCAAAGACAGG -3'
(R):5'- GCTCAGATACCTAGTGCCTGTAG -3'
Posted On2015-10-21