Incidental Mutation 'R4706:Myo1d'
ID355245
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Namemyosin ID
Synonyms9930104H07Rik, D11Ertd9e
MMRRC Submission 041954-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4706 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location80482126-80780025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80666641 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 491 (C491Y)
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
Predicted Effect probably damaging
Transcript: ENSMUST00000041065
AA Change: C491Y

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: C491Y

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070997
AA Change: C491Y

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: C491Y

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,279 M353K probably benign Het
Abca16 T A 7: 120,465,765 N548K probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Afap1l2 A T 19: 56,937,240 I152N possibly damaging Het
Ankrd52 T G 10: 128,378,161 M62R probably benign Het
Aox4 A T 1: 58,266,787 T1317S probably damaging Het
Apol7c T A 15: 77,525,723 Q341L probably benign Het
Arhgef4 C T 1: 34,732,217 R1202W probably benign Het
B4galnt2 C T 11: 95,876,097 probably null Het
BC049762 A T 11: 51,253,841 F204L possibly damaging Het
Cecr2 A T 6: 120,755,578 E477V possibly damaging Het
Chmp7 A T 14: 69,718,561 D419E probably benign Het
Cmip A C 8: 117,377,154 K127T probably damaging Het
Csmd2 T C 4: 128,544,751 V3041A probably benign Het
Cyp1b1 T A 17: 79,713,342 I324F possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Ddx10 T C 9: 53,233,931 T249A probably damaging Het
Dscaml1 T C 9: 45,450,580 Y213H probably damaging Het
Eef1a2 T C 2: 181,155,357 D17G probably damaging Het
Fbn1 T C 2: 125,370,149 I848V probably benign Het
Fbxw18 A G 9: 109,690,517 I307T probably benign Het
Fxr1 T A 3: 34,064,129 D500E probably damaging Het
Gars G A 6: 55,069,378 G492D probably damaging Het
Gria2 A T 3: 80,740,990 D146E probably benign Het
Gstz1 A G 12: 87,159,120 N37S probably benign Het
Hnrnph3 C A 10: 63,017,280 G194V probably damaging Het
Il2rb T C 15: 78,486,400 R172G possibly damaging Het
Itga11 T A 9: 62,755,296 V517D possibly damaging Het
Kcnq4 A G 4: 120,704,486 I462T probably benign Het
Klf6 T A 13: 5,861,640 M1K probably null Het
Lrp8 G A 4: 107,861,273 A817T probably benign Het
Map3k5 T A 10: 20,058,938 Y509N probably damaging Het
Mdc1 C T 17: 35,852,779 S1073F probably damaging Het
Mme A G 3: 63,348,712 D531G possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 A T 4: 106,691,624 V1014E possibly damaging Het
Ncoa3 C A 2: 166,047,879 D61E probably damaging Het
Nmrk1 A G 19: 18,645,127 E190G probably benign Het
Nr4a2 G T 2: 57,112,213 P13H probably damaging Het
Nup205 T C 6: 35,202,008 L671P probably damaging Het
Olfr1058 G A 2: 86,386,388 T10I probably benign Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr429 A G 1: 174,089,702 I221V probably damaging Het
Olfr568 T A 7: 102,877,433 H104Q probably damaging Het
Omt2a T C 9: 78,313,070 I16V probably benign Het
Osbpl9 A T 4: 109,156,687 I70N probably damaging Het
Pclo A T 5: 14,714,207 L4231F unknown Het
Per1 C T 11: 69,100,618 probably benign Het
Perm1 G T 4: 156,217,074 C25F probably damaging Het
Phf3 A G 1: 30,805,606 V1424A probably damaging Het
Plxnb1 T G 9: 109,112,028 L1625R probably damaging Het
Ppid G A 3: 79,599,052 V216I probably benign Het
Ppp4r3a C T 12: 101,041,916 G754D probably damaging Het
Prex2 G T 1: 11,199,988 W1299L probably damaging Het
Ptprn2 C A 12: 116,872,094 Q350K probably benign Het
Ralyl G A 3: 14,039,790 probably null Het
Rbm8a G A 3: 96,630,052 probably benign Het
Ros1 A G 10: 52,101,894 S1419P possibly damaging Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Rtel1 T C 2: 181,323,746 probably null Het
Sacs A G 14: 61,204,273 E1256G probably damaging Het
Sec23a A G 12: 58,982,586 V467A probably damaging Het
Sec24d T A 3: 123,355,778 N811K possibly damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shisa5 T A 9: 109,056,060 C133S probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a31 G A 3: 40,716,545 A89T probably damaging Het
Slc6a1 G T 6: 114,307,752 R257L possibly damaging Het
Sntb1 C T 15: 55,749,274 V303M probably benign Het
Snx20 A G 8: 88,627,811 V97A probably damaging Het
Vmn1r29 T A 6: 58,308,151 N285K probably benign Het
Vmn2r98 T G 17: 19,069,745 S514R probably damaging Het
Zfp28 A T 7: 6,389,794 E156D probably damaging Het
Zfp39 A G 11: 58,902,807 V35A probably benign Het
Zfp536 A C 7: 37,569,466 I175S probably damaging Het
Zic5 A T 14: 122,459,557 S549T unknown Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
horton UTSW 11 80674708 missense probably damaging 1.00
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper UTSW 11 80484332 missense probably damaging 0.99
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80684395 missense probably damaging 1.00
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2497:Myo1d UTSW 11 80674821 missense probably damaging 1.00
R2512:Myo1d UTSW 11 80779717 missense probably benign 0.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4723:Myo1d UTSW 11 80779841 utr 5 prime probably benign
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7077:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7650:Myo1d UTSW 11 80601684 missense probably benign
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R8324:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R8329:Myo1d UTSW 11 80638074 missense probably benign 0.21
R8474:Myo1d UTSW 11 80670919 missense possibly damaging 0.93
R8799:Myo1d UTSW 11 80684379 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80674932 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80676932 missense probably benign 0.30
R8823:Myo1d UTSW 11 80601745 missense possibly damaging 0.91
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTATGGCACTTTCCTCAAACC -3'
(R):5'- TCTGCCAAAAGCCTGTACC -3'

Sequencing Primer
(F):5'- TACGCTCGCTCATCTACAAAATG -3'
(R):5'- GTACCTTGTCAGCCGTGGATTTAAAC -3'
Posted On2015-10-21