Mutagenetix > Incidental Mutation

Incidental Mutation 'R4706:Ptprn2'

355252

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

041954-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R4706 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 116872094 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 350 (Q350K)

Ref Sequence

ENSEMBL: ENSMUSP00000139978 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

AlphaFold

P80560

Predicted Effect

probably benign
Transcript: ENSMUST00000070733
AA Change: Q350K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: Q350K

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189009

Predicted Effect

probably benign
Transcript: ENSMUST00000190247
AA Change: Q350K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: Q350K

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,692,279	M353K	probably benign	Het
Abca16	T	A	7: 120,465,765	N548K	probably damaging	Het
Abcd2	T	C	15: 91,159,182	D601G	probably benign	Het
Afap1l2	A	T	19: 56,937,240	I152N	possibly damaging	Het
Ankrd52	T	G	10: 128,378,161	M62R	probably benign	Het
Aox4	A	T	1: 58,266,787	T1317S	probably damaging	Het
Apol7c	T	A	15: 77,525,723	Q341L	probably benign	Het
Arhgef4	C	T	1: 34,732,217	R1202W	probably benign	Het
B4galnt2	C	T	11: 95,876,097		probably null	Het
BC049762	A	T	11: 51,253,841	F204L	possibly damaging	Het
Cecr2	A	T	6: 120,755,578	E477V	possibly damaging	Het
Chmp7	A	T	14: 69,718,561	D419E	probably benign	Het
Cmip	A	C	8: 117,377,154	K127T	probably damaging	Het
Csmd2	T	C	4: 128,544,751	V3041A	probably benign	Het
Cyp1b1	T	A	17: 79,713,342	I324F	possibly damaging	Het
Dapp1	T	C	3: 137,933,167	D225G	probably benign	Het
Ddx10	T	C	9: 53,233,931	T249A	probably damaging	Het
Dscaml1	T	C	9: 45,450,580	Y213H	probably damaging	Het
Eef1a2	T	C	2: 181,155,357	D17G	probably damaging	Het
Fbn1	T	C	2: 125,370,149	I848V	probably benign	Het
Fbxw18	A	G	9: 109,690,517	I307T	probably benign	Het
Fxr1	T	A	3: 34,064,129	D500E	probably damaging	Het
Gars	G	A	6: 55,069,378	G492D	probably damaging	Het
Gria2	A	T	3: 80,740,990	D146E	probably benign	Het
Gstz1	A	G	12: 87,159,120	N37S	probably benign	Het
Hnrnph3	C	A	10: 63,017,280	G194V	probably damaging	Het
Il2rb	T	C	15: 78,486,400	R172G	possibly damaging	Het
Itga11	T	A	9: 62,755,296	V517D	possibly damaging	Het
Kcnq4	A	G	4: 120,704,486	I462T	probably benign	Het
Klf6	T	A	13: 5,861,640	M1K	probably null	Het
Lrp8	G	A	4: 107,861,273	A817T	probably benign	Het
Map3k5	T	A	10: 20,058,938	Y509N	probably damaging	Het
Mdc1	C	T	17: 35,852,779	S1073F	probably damaging	Het
Mme	A	G	3: 63,348,712	D531G	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mroh7	A	T	4: 106,691,624	V1014E	possibly damaging	Het
Myo1d	C	T	11: 80,666,641	C491Y	probably damaging	Het
Ncoa3	C	A	2: 166,047,879	D61E	probably damaging	Het
Nmrk1	A	G	19: 18,645,127	E190G	probably benign	Het
Nr4a2	G	T	2: 57,112,213	P13H	probably damaging	Het
Nup205	T	C	6: 35,202,008	L671P	probably damaging	Het
Olfr1058	G	A	2: 86,386,388	T10I	probably benign	Het
Olfr1221	A	T	2: 89,112,232	F93L	probably damaging	Het
Olfr284	G	T	15: 98,340,778	H70Q	possibly damaging	Het
Olfr429	A	G	1: 174,089,702	I221V	probably damaging	Het
Olfr568	T	A	7: 102,877,433	H104Q	probably damaging	Het
Omt2a	T	C	9: 78,313,070	I16V	probably benign	Het
Osbpl9	A	T	4: 109,156,687	I70N	probably damaging	Het
Pclo	A	T	5: 14,714,207	L4231F	unknown	Het
Per1	C	T	11: 69,100,618		probably benign	Het
Perm1	G	T	4: 156,217,074	C25F	probably damaging	Het
Phf3	A	G	1: 30,805,606	V1424A	probably damaging	Het
Plxnb1	T	G	9: 109,112,028	L1625R	probably damaging	Het
Ppid	G	A	3: 79,599,052	V216I	probably benign	Het
Ppp4r3a	C	T	12: 101,041,916	G754D	probably damaging	Het
Prex2	G	T	1: 11,199,988	W1299L	probably damaging	Het
Ralyl	G	A	3: 14,039,790		probably null	Het
Rbm8a	G	A	3: 96,630,052		probably benign	Het
Ros1	A	G	10: 52,101,894	S1419P	possibly damaging	Het
Rps6ka5	T	A	12: 100,581,319	I311F	probably damaging	Het
Rps6ka5	C	T	12: 100,597,885		probably null	Het
Rtel1	T	C	2: 181,323,746		probably null	Het
Sacs	A	G	14: 61,204,273	E1256G	probably damaging	Het
Sec23a	A	G	12: 58,982,586	V467A	probably damaging	Het
Sec24d	T	A	3: 123,355,778	N811K	possibly damaging	Het
Sf3b1	G	A	1: 54,990,507	T1112M	probably damaging	Het
Shisa5	T	A	9: 109,056,060	C133S	probably null	Het
Slc16a6	A	G	11: 109,463,367	S59P	probably benign	Het
Slc25a31	G	A	3: 40,716,545	A89T	probably damaging	Het
Slc6a1	G	T	6: 114,307,752	R257L	possibly damaging	Het
Sntb1	C	T	15: 55,749,274	V303M	probably benign	Het
Snx20	A	G	8: 88,627,811	V97A	probably damaging	Het
Vmn1r29	T	A	6: 58,308,151	N285K	probably benign	Het
Vmn2r98	T	G	17: 19,069,745	S514R	probably damaging	Het
Zfp28	A	T	7: 6,389,794	E156D	probably damaging	Het
Zfp39	A	G	11: 58,902,807	V35A	probably benign	Het
Zfp536	A	C	7: 37,569,466	I175S	probably damaging	Het
Zic5	A	T	14: 122,459,557	S549T	unknown	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
BB001:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117212008	splice site	probably null
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117161709	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117247717	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116876000	missense	probably damaging	1.00
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R4970:Ptprn2	UTSW	12	117276595	missense	probably damaging	1.00
R5208:Ptprn2	UTSW	12	116858928	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R6465:Ptprn2	UTSW	12	117269589	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117227225	splice site	probably null
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117248544	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7460:Ptprn2	UTSW	12	117248681	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117184737	missense	probably benign	0.30
R8716:Ptprn2	UTSW	12	117255548	missense	possibly damaging	0.73
R9235:Ptprn2	UTSW	12	117269651	critical splice donor site	probably null
R9605:Ptprn2	UTSW	12	117161658	missense	probably benign	0.13
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- TGCCCTTAGACACACTCCTG -3'
(R):5'- TATGGCCTGGTGAGAAGGATTC -3'

Sequencing Primer
(F):5'- TCCTGCAGAGTCTCCTGAAG -3'
(R):5'- GTGGTCTTACTACCTCCCTAGATTC -3'

Posted On

2015-10-21