Mutagenetix > Incidental Mutations

Incidental Mutation 'R4706:Klf6'

355253

Institutional Source

Beutler Lab

Gene Symbol

Klf6

Ensembl Gene

ENSMUSG00000000078

Gene Name

Kruppel-like factor 6

Synonyms

BCD1, Copeb, FM6, Zf9, Ierepo3, CPBP, FM2, Ierepo1

MMRRC Submission

041954-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4706 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5861482-5870394 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to A at 5861640 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1 (M1K)

Ref Sequence

ENSEMBL: ENSMUSP00000152088 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000080] [ENSMUST00000222857]

Predicted Effect

probably null
Transcript: ENSMUST00000000080
AA Change: M1K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000000080
Gene: ENSMUSG00000000078
AA Change: M1K

Domain	Start	End	E-Value	Type
low complexity region	107	129	N/A	INTRINSIC
low complexity region	137	155	N/A	INTRINSIC
low complexity region	168	187	N/A	INTRINSIC
ZnF_C2H2	235	259	1.08e-1	SMART
ZnF_C2H2	265	289	1.13e-4	SMART
ZnF_C2H2	295	317	6.32e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186843

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221734

Predicted Effect

probably null
Transcript: ENSMUST00000222857
AA Change: M1K

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223142

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel-like family of transcription factors. The zinc finger protein is a transcriptional activator, and functions as a tumor suppressor. Multiple transcript variants encoding different isoforms have been found for this gene, some of which are implicated in carcinogenesis. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, small size, pallor, decreased cellular proliferation and delayed liver development. Mice heterozygous for a null allele exhibit delays in embryonic hematopoeisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,692,279	M353K	probably benign	Het
Abca16	T	A	7: 120,465,765	N548K	probably damaging	Het
Abcd2	T	C	15: 91,159,182	D601G	probably benign	Het
Afap1l2	A	T	19: 56,937,240	I152N	possibly damaging	Het
Ankrd52	T	G	10: 128,378,161	M62R	probably benign	Het
Aox4	A	T	1: 58,266,787	T1317S	probably damaging	Het
Apol7c	T	A	15: 77,525,723	Q341L	probably benign	Het
Arhgef4	C	T	1: 34,732,217	R1202W	probably benign	Het
B4galnt2	C	T	11: 95,876,097		probably null	Het
BC049762	A	T	11: 51,253,841	F204L	possibly damaging	Het
Cecr2	A	T	6: 120,755,578	E477V	possibly damaging	Het
Chmp7	A	T	14: 69,718,561	D419E	probably benign	Het
Cmip	A	C	8: 117,377,154	K127T	probably damaging	Het
Csmd2	T	C	4: 128,544,751	V3041A	probably benign	Het
Cyp1b1	T	A	17: 79,713,342	I324F	possibly damaging	Het
Dapp1	T	C	3: 137,933,167	D225G	probably benign	Het
Ddx10	T	C	9: 53,233,931	T249A	probably damaging	Het
Dscaml1	T	C	9: 45,450,580	Y213H	probably damaging	Het
Eef1a2	T	C	2: 181,155,357	D17G	probably damaging	Het
Fbn1	T	C	2: 125,370,149	I848V	probably benign	Het
Fbxw18	A	G	9: 109,690,517	I307T	probably benign	Het
Fxr1	T	A	3: 34,064,129	D500E	probably damaging	Het
Gars	G	A	6: 55,069,378	G492D	probably damaging	Het
Gria2	A	T	3: 80,740,990	D146E	probably benign	Het
Gstz1	A	G	12: 87,159,120	N37S	probably benign	Het
Hnrnph3	C	A	10: 63,017,280	G194V	probably damaging	Het
Il2rb	T	C	15: 78,486,400	R172G	possibly damaging	Het
Itga11	T	A	9: 62,755,296	V517D	possibly damaging	Het
Kcnq4	A	G	4: 120,704,486	I462T	probably benign	Het
Lrp8	G	A	4: 107,861,273	A817T	probably benign	Het
Map3k5	T	A	10: 20,058,938	Y509N	probably damaging	Het
Mdc1	C	T	17: 35,852,779	S1073F	probably damaging	Het
Mme	A	G	3: 63,348,712	D531G	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mroh7	A	T	4: 106,691,624	V1014E	possibly damaging	Het
Myo1d	C	T	11: 80,666,641	C491Y	probably damaging	Het
Ncoa3	C	A	2: 166,047,879	D61E	probably damaging	Het
Nmrk1	A	G	19: 18,645,127	E190G	probably benign	Het
Nr4a2	G	T	2: 57,112,213	P13H	probably damaging	Het
Nup205	T	C	6: 35,202,008	L671P	probably damaging	Het
Olfr1058	G	A	2: 86,386,388	T10I	probably benign	Het
Olfr1221	A	T	2: 89,112,232	F93L	probably damaging	Het
Olfr284	G	T	15: 98,340,778	H70Q	possibly damaging	Het
Olfr429	A	G	1: 174,089,702	I221V	probably damaging	Het
Olfr568	T	A	7: 102,877,433	H104Q	probably damaging	Het
Omt2a	T	C	9: 78,313,070	I16V	probably benign	Het
Osbpl9	A	T	4: 109,156,687	I70N	probably damaging	Het
Pclo	A	T	5: 14,714,207	L4231F	unknown	Het
Per1	C	T	11: 69,100,618		probably benign	Het
Perm1	G	T	4: 156,217,074	C25F	probably damaging	Het
Phf3	A	G	1: 30,805,606	V1424A	probably damaging	Het
Plxnb1	T	G	9: 109,112,028	L1625R	probably damaging	Het
Ppid	G	A	3: 79,599,052	V216I	probably benign	Het
Ppp4r3a	C	T	12: 101,041,916	G754D	probably damaging	Het
Prex2	G	T	1: 11,199,988	W1299L	probably damaging	Het
Ptprn2	C	A	12: 116,872,094	Q350K	probably benign	Het
Ralyl	G	A	3: 14,039,790		probably null	Het
Rbm8a	G	A	3: 96,630,052		probably benign	Het
Ros1	A	G	10: 52,101,894	S1419P	possibly damaging	Het
Rps6ka5	T	A	12: 100,581,319	I311F	probably damaging	Het
Rps6ka5	C	T	12: 100,597,885		probably null	Het
Rtel1	T	C	2: 181,323,746		probably null	Het
Sacs	A	G	14: 61,204,273	E1256G	probably damaging	Het
Sec23a	A	G	12: 58,982,586	V467A	probably damaging	Het
Sec24d	T	A	3: 123,355,778	N811K	possibly damaging	Het
Sf3b1	G	A	1: 54,990,507	T1112M	probably damaging	Het
Shisa5	T	A	9: 109,056,060	C133S	probably null	Het
Slc16a6	A	G	11: 109,463,367	S59P	probably benign	Het
Slc25a31	G	A	3: 40,716,545	A89T	probably damaging	Het
Slc6a1	G	T	6: 114,307,752	R257L	possibly damaging	Het
Sntb1	C	T	15: 55,749,274	V303M	probably benign	Het
Snx20	A	G	8: 88,627,811	V97A	probably damaging	Het
Vmn1r29	T	A	6: 58,308,151	N285K	probably benign	Het
Vmn2r98	T	G	17: 19,069,745	S514R	probably damaging	Het
Zfp28	A	T	7: 6,389,794	E156D	probably damaging	Het
Zfp39	A	G	11: 58,902,807	V35A	probably benign	Het
Zfp536	A	C	7: 37,569,466	I175S	probably damaging	Het
Zic5	A	T	14: 122,459,557	S549T	unknown	Het

Other mutations in Klf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Klf6	APN	13	5861681	missense	probably benign	0.02
IGL01714:Klf6	APN	13	5866659	missense	probably benign	0.25
IGL02606:Klf6	APN	13	5866735	missense	probably damaging	1.00
H8786:Klf6	UTSW	13	5861791	missense	probably damaging	0.98
R0689:Klf6	UTSW	13	5865116	missense	probably damaging	1.00
R1174:Klf6	UTSW	13	5861712	missense	probably benign	0.06
R1175:Klf6	UTSW	13	5861712	missense	probably benign	0.06
R4949:Klf6	UTSW	13	5864948	missense	probably benign	0.01
R7982:Klf6	UTSW	13	5861823	missense	probably damaging	0.99
Z1177:Klf6	UTSW	13	5864882	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGTGCGAGCTGACATCATC -3'
(R):5'- AGAAGTAGCCCGTTTCGTG -3'

Sequencing Primer
(F):5'- AGCTGACATCATCGTCGC -3'
(R):5'- GCACAATCTGTAGTTCCTGGAAG -3'

Posted On

2015-10-21