Incidental Mutation 'R4706:Il2rb'
ID 355259
Institutional Source Beutler Lab
Gene Symbol Il2rb
Ensembl Gene ENSMUSG00000068227
Gene Name interleukin 2 receptor, beta chain
Synonyms IL-15 receptor beta chain, CD122, IL-15Rbeta, IL15Rbeta, IL-2/15Rbeta, Il-2Rbeta
MMRRC Submission 041954-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.100) question?
Stock # R4706 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 78479256-78495271 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78486400 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 172 (R172G)
Ref Sequence ENSEMBL: ENSMUSP00000127006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089398] [ENSMUST00000163494]
AlphaFold P16297
Predicted Effect possibly damaging
Transcript: ENSMUST00000089398
AA Change: R172G

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000086820
Gene: ENSMUSG00000068227
AA Change: R172G

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163494
AA Change: R172G

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127006
Gene: ENSMUSG00000068227
AA Change: R172G

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: The interleukin 2 receptor is composed of alpha and beta subunits. The beta subunit encoded by this gene is very homologous to the human beta subunit and also shows structural similarity to other cytokine receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous activation of T cells and differentiation of B cells, elevated immunoglobulins including autoantibodies causing hemolytic anemia, granulocytopoiesis, and death after 3 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,279 M353K probably benign Het
Abca16 T A 7: 120,465,765 N548K probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Afap1l2 A T 19: 56,937,240 I152N possibly damaging Het
Ankrd52 T G 10: 128,378,161 M62R probably benign Het
Aox4 A T 1: 58,266,787 T1317S probably damaging Het
Apol7c T A 15: 77,525,723 Q341L probably benign Het
Arhgef4 C T 1: 34,732,217 R1202W probably benign Het
B4galnt2 C T 11: 95,876,097 probably null Het
BC049762 A T 11: 51,253,841 F204L possibly damaging Het
Cecr2 A T 6: 120,755,578 E477V possibly damaging Het
Chmp7 A T 14: 69,718,561 D419E probably benign Het
Cmip A C 8: 117,377,154 K127T probably damaging Het
Csmd2 T C 4: 128,544,751 V3041A probably benign Het
Cyp1b1 T A 17: 79,713,342 I324F possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Ddx10 T C 9: 53,233,931 T249A probably damaging Het
Dscaml1 T C 9: 45,450,580 Y213H probably damaging Het
Eef1a2 T C 2: 181,155,357 D17G probably damaging Het
Fbn1 T C 2: 125,370,149 I848V probably benign Het
Fbxw18 A G 9: 109,690,517 I307T probably benign Het
Fxr1 T A 3: 34,064,129 D500E probably damaging Het
Gars G A 6: 55,069,378 G492D probably damaging Het
Gria2 A T 3: 80,740,990 D146E probably benign Het
Gstz1 A G 12: 87,159,120 N37S probably benign Het
Hnrnph3 C A 10: 63,017,280 G194V probably damaging Het
Itga11 T A 9: 62,755,296 V517D possibly damaging Het
Kcnq4 A G 4: 120,704,486 I462T probably benign Het
Klf6 T A 13: 5,861,640 M1K probably null Het
Lrp8 G A 4: 107,861,273 A817T probably benign Het
Map3k5 T A 10: 20,058,938 Y509N probably damaging Het
Mdc1 C T 17: 35,852,779 S1073F probably damaging Het
Mme A G 3: 63,348,712 D531G possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 A T 4: 106,691,624 V1014E possibly damaging Het
Myo1d C T 11: 80,666,641 C491Y probably damaging Het
Ncoa3 C A 2: 166,047,879 D61E probably damaging Het
Nmrk1 A G 19: 18,645,127 E190G probably benign Het
Nr4a2 G T 2: 57,112,213 P13H probably damaging Het
Nup205 T C 6: 35,202,008 L671P probably damaging Het
Olfr1058 G A 2: 86,386,388 T10I probably benign Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr429 A G 1: 174,089,702 I221V probably damaging Het
Olfr568 T A 7: 102,877,433 H104Q probably damaging Het
Omt2a T C 9: 78,313,070 I16V probably benign Het
Osbpl9 A T 4: 109,156,687 I70N probably damaging Het
Pclo A T 5: 14,714,207 L4231F unknown Het
Per1 C T 11: 69,100,618 probably benign Het
Perm1 G T 4: 156,217,074 C25F probably damaging Het
Phf3 A G 1: 30,805,606 V1424A probably damaging Het
Plxnb1 T G 9: 109,112,028 L1625R probably damaging Het
Ppid G A 3: 79,599,052 V216I probably benign Het
Ppp4r3a C T 12: 101,041,916 G754D probably damaging Het
Prex2 G T 1: 11,199,988 W1299L probably damaging Het
Ptprn2 C A 12: 116,872,094 Q350K probably benign Het
Ralyl G A 3: 14,039,790 probably null Het
Rbm8a G A 3: 96,630,052 probably benign Het
Ros1 A G 10: 52,101,894 S1419P possibly damaging Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Rtel1 T C 2: 181,323,746 probably null Het
Sacs A G 14: 61,204,273 E1256G probably damaging Het
Sec23a A G 12: 58,982,586 V467A probably damaging Het
Sec24d T A 3: 123,355,778 N811K possibly damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shisa5 T A 9: 109,056,060 C133S probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a31 G A 3: 40,716,545 A89T probably damaging Het
Slc6a1 G T 6: 114,307,752 R257L possibly damaging Het
Sntb1 C T 15: 55,749,274 V303M probably benign Het
Snx20 A G 8: 88,627,811 V97A probably damaging Het
Vmn1r29 T A 6: 58,308,151 N285K probably benign Het
Vmn2r98 T G 17: 19,069,745 S514R probably damaging Het
Zfp28 A T 7: 6,389,794 E156D probably damaging Het
Zfp39 A G 11: 58,902,807 V35A probably benign Het
Zfp536 A C 7: 37,569,466 I175S probably damaging Het
Zic5 A T 14: 122,459,557 S549T unknown Het
Other mutations in Il2rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Il2rb APN 15 78481697 missense probably benign 0.00
Bonnerhall UTSW 15 78485004 missense probably benign
diptera UTSW 15 78485806 missense probably damaging 1.00
flybase UTSW 15 78491848 start codon destroyed probably null 0.66
Halfmeasure UTSW 15 78486481 missense probably benign 0.04
Moonpie UTSW 15 78481834 frame shift probably null
tetragonal UTSW 15 78485753 missense probably benign
Whistles UTSW 15 78481936 missense possibly damaging 0.72
R0581:Il2rb UTSW 15 78481936 missense possibly damaging 0.72
R1795:Il2rb UTSW 15 78483987 missense probably damaging 1.00
R1932:Il2rb UTSW 15 78491777 missense possibly damaging 0.93
R2924:Il2rb UTSW 15 78491849 start codon destroyed probably null 0.27
R5713:Il2rb UTSW 15 78491848 start codon destroyed probably null 0.66
R5953:Il2rb UTSW 15 78484982 nonsense probably null
R6018:Il2rb UTSW 15 78482066 missense possibly damaging 0.54
R6279:Il2rb UTSW 15 78481538 missense possibly damaging 0.72
R6666:Il2rb UTSW 15 78481834 frame shift probably null
R6961:Il2rb UTSW 15 78485824 missense probably damaging 1.00
R8020:Il2rb UTSW 15 78485004 missense probably benign
R8477:Il2rb UTSW 15 78485806 missense probably damaging 1.00
R8854:Il2rb UTSW 15 78485753 missense probably benign
R8976:Il2rb UTSW 15 78486481 missense probably benign 0.04
R8979:Il2rb UTSW 15 78491852 start gained probably benign
R9509:Il2rb UTSW 15 78490216 missense probably damaging 0.97
R9541:Il2rb UTSW 15 78488193 missense probably benign 0.00
R9745:Il2rb UTSW 15 78488199 missense probably benign 0.00
X0018:Il2rb UTSW 15 78485765 missense probably damaging 1.00
X0066:Il2rb UTSW 15 78484956 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGTGGCTGCCAAGTCTCAG -3'
(R):5'- AAACTGGTTTGCAAGTTCTTGG -3'

Sequencing Primer
(F):5'- GCCTTAACTCGAGGGACTACATAG -3'
(R):5'- GGTTTGCAAGTTCTTGGTATCATAC -3'
Posted On 2015-10-21