Incidental Mutation 'R0211:Gp6'
ID35526
Institutional Source Beutler Lab
Gene Symbol Gp6
Ensembl Gene ENSMUSG00000078810
Gene Nameglycoprotein 6 (platelet)
SynonymsGpvi, 9830166G18Rik
MMRRC Submission 038462-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0211 (G1)
Quality Score128
Status Not validated
Chromosome7
Chromosomal Location4363965-4397744 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 4373209 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108590] [ENSMUST00000206928]
Predicted Effect probably null
Transcript: ENSMUST00000108590
SMART Domains Protein: ENSMUSP00000104231
Gene: ENSMUSG00000078810

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 34 109 7.47e-3 SMART
IG 120 204 9.86e-3 SMART
transmembrane domain 266 285 N/A INTRINSIC
low complexity region 306 312 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000206928
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a platelet membrane glycoprotein of the immunoglobulin superfamily. The encoded protein is a receptor for collagen and plays a critical role in collagen-induced platelet aggregation and thrombus formation. The encoded protein forms a complex with the Fc receptor gamma-chain that initiates the platelet activation signaling cascade upon collagen binding. Mutations in this gene are a cause of platelet-type bleeding disorder-11 (BDPLT11). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous with disruptions in this gene display functional abnormalities in their platelets including failure of the platelets to aggregate and to become activated. The effects on blood clotting are minor however. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,216,096 L1401P possibly damaging Het
4930503B20Rik C T 3: 146,650,496 R219H probably benign Het
Abcc9 T A 6: 142,688,984 I185F probably benign Het
Adgrf1 T C 17: 43,296,690 L100P probably damaging Het
Akt1 T C 12: 112,655,142 T407A probably damaging Het
Alk C T 17: 72,603,516 R65H probably damaging Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Arhgef12 G A 9: 42,972,004 R1411C probably damaging Het
Arnt T A 3: 95,476,149 M242K probably damaging Het
Atad5 T G 11: 80,095,647 V520G probably benign Het
Avpr1a T A 10: 122,449,469 M222K possibly damaging Het
Cbr2 T A 11: 120,730,788 I88L probably benign Het
Cc2d2a T A 5: 43,688,266 probably null Het
Ccdc51 T C 9: 109,089,373 M10T probably benign Het
Cntnap5b T A 1: 100,478,374 D1136E possibly damaging Het
Coil T A 11: 88,982,153 S447T probably damaging Het
Cryba1 T A 11: 77,718,867 Y179F probably damaging Het
Dcaf4 T A 12: 83,535,961 F277I probably damaging Het
Ddost G A 4: 138,309,602 V159M probably damaging Het
Dnajb6 T C 5: 29,785,079 probably benign Het
Dnase2a A G 8: 84,908,788 probably benign Het
Dscam T C 16: 96,716,079 I877V possibly damaging Het
Dyx1c1 A T 9: 72,961,367 R127S possibly damaging Het
Efcc1 A T 6: 87,749,154 T312S probably benign Het
Ermard A T 17: 15,021,943 Q127L probably damaging Het
F2 T C 2: 91,630,158 E329G probably damaging Het
Foxc2 T A 8: 121,116,616 M1K probably null Het
Fuz T A 7: 44,899,022 probably null Het
Ggnbp2 G A 11: 84,840,313 T325M probably damaging Het
Gm6408 T A 5: 146,483,060 F115I probably benign Het
Gm8909 T C 17: 36,168,007 T117A probably damaging Het
Grin2a A G 16: 9,579,173 S1017P possibly damaging Het
Hmmr A T 11: 40,714,808 M318K probably damaging Het
Ifi205 T C 1: 174,028,428 E12G probably benign Het
Ift74 C T 4: 94,679,255 T395I probably benign Het
Ikbkap T A 4: 56,795,545 I143F probably damaging Het
Irf8 A T 8: 120,739,975 D53V probably damaging Het
Itgad A G 7: 128,204,641 Y69C probably damaging Het
Itpr2 C A 6: 146,194,613 R2084L probably benign Het
Krt4 C A 15: 101,922,782 S228I possibly damaging Het
Lpin3 A T 2: 160,898,681 D382V probably damaging Het
Ltbp3 T C 19: 5,752,143 probably null Het
Map4k3 C T 17: 80,644,841 A179T probably damaging Het
Nck1 A T 9: 100,497,767 W144R probably damaging Het
Ndufb9 A T 15: 58,939,282 Q139L possibly damaging Het
Ngfr T G 11: 95,571,912 E300A probably damaging Het
Nin T G 12: 70,014,875 T2072P probably damaging Het
Nop2 T G 6: 125,141,344 L529R probably damaging Het
Nrm T A 17: 35,864,611 L203Q probably damaging Het
Nynrin T C 14: 55,871,798 F1454S probably benign Het
Olfr1062 A C 2: 86,423,107 S190A probably damaging Het
Olfr1328 T A 4: 118,934,270 M191L probably benign Het
Olfr1453 T C 19: 13,028,282 T16A possibly damaging Het
Os9 A G 10: 127,121,036 V27A probably damaging Het
Osbpl9 T G 4: 109,073,124 T332P probably damaging Het
Pcdhb10 A T 18: 37,414,006 M712L probably benign Het
Pcx C T 19: 4,620,199 A935V probably damaging Het
Pdzd7 A G 19: 45,033,667 V514A possibly damaging Het
Plin4 C T 17: 56,102,242 G1326D probably damaging Het
Plxnb1 T A 9: 109,103,663 Y568* probably null Het
Pmfbp1 T A 8: 109,541,740 V973D probably benign Het
Ppp2r1b T C 9: 50,861,625 V70A probably benign Het
Prkar2b C A 12: 31,972,184 V201L probably benign Het
Rgr T G 14: 37,046,968 T37P probably damaging Het
Ripk3 A T 14: 55,787,918 L63Q probably damaging Het
Rpusd2 A G 2: 119,038,412 S439G probably benign Het
Serac1 T A 17: 6,050,060 R438S possibly damaging Het
Slc19a1 T A 10: 77,038,466 S24T possibly damaging Het
Slc6a21 A C 7: 45,288,243 T653P possibly damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spdef C T 17: 27,714,920 R309H probably damaging Het
Srp68 A T 11: 116,265,551 Y84N probably damaging Het
Syne2 A T 12: 76,097,957 Q6299L probably damaging Het
Tmem63b T A 17: 45,661,913 M652L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnk1 A G 11: 69,855,181 V306A probably damaging Het
Tnnc2 T A 2: 164,777,484 I147F probably damaging Het
Tnni3k C T 3: 155,055,344 probably benign Het
Togaram2 T A 17: 71,729,248 V911D probably damaging Het
Tyw3 T C 3: 154,587,495 N181S probably damaging Het
Unc79 T A 12: 103,072,792 S682T probably benign Het
Vps13d A G 4: 145,114,778 L2634S probably benign Het
Wasl G T 6: 24,633,893 A124E probably damaging Het
Zfp287 T C 11: 62,714,917 H388R probably damaging Het
Zfp335 T C 2: 164,907,692 T262A probably damaging Het
Zfp457 C G 13: 67,293,147 G359R probably benign Het
Zfp536 T A 7: 37,568,449 E514V probably damaging Het
Zfp872 T A 9: 22,200,173 I316N probably damaging Het
Other mutations in Gp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Gp6 APN 7 4394104 splice site probably benign
IGL02351:Gp6 APN 7 4394508 missense probably benign 0.03
IGL02358:Gp6 APN 7 4394508 missense probably benign 0.03
IGL02660:Gp6 APN 7 4384998 missense probably benign 0.01
IGL03081:Gp6 APN 7 4371648 missense probably benign 0.01
R0112:Gp6 UTSW 7 4370184 missense probably benign 0.08
R0112:Gp6 UTSW 7 4371627 missense probably benign 0.12
R0356:Gp6 UTSW 7 4370142 splice site probably benign
R2006:Gp6 UTSW 7 4384989 missense probably benign 0.33
R2047:Gp6 UTSW 7 4373271 splice site probably benign
R5219:Gp6 UTSW 7 4368999 missense possibly damaging 0.70
R5571:Gp6 UTSW 7 4368900 missense probably damaging 1.00
R5639:Gp6 UTSW 7 4394131 missense probably damaging 1.00
R6224:Gp6 UTSW 7 4394212 missense probably benign 0.03
R6555:Gp6 UTSW 7 4384930 missense probably damaging 0.99
R7625:Gp6 UTSW 7 4370174 missense probably benign 0.37
R8113:Gp6 UTSW 7 4394115 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCTGGCTTGTATTTGTGCAGTTAAAACC -3'
(R):5'- CCAGTCACTCAGCAGTGGAAACTTC -3'

Sequencing Primer
(F):5'- GCAGTTAAAACCATCTTATTGGACAC -3'
(R):5'- CAGCAGTGGAAACTTCTTCATATTC -3'
Posted On2013-05-09