Incidental Mutation 'R4706:Vmn2r98'
ID 355263
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission 041954-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R4706 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 19273755-19301573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 19290007 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 514 (S514R)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably damaging
Transcript: ENSMUST00000170424
AA Change: S514R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: S514R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,064,988 (GRCm39) N548K probably damaging Het
Abcd2 T C 15: 91,043,385 (GRCm39) D601G probably benign Het
Afap1l2 A T 19: 56,925,672 (GRCm39) I152N possibly damaging Het
Ankrd52 T G 10: 128,214,030 (GRCm39) M62R probably benign Het
Aox4 A T 1: 58,305,946 (GRCm39) T1317S probably damaging Het
Apol7c T A 15: 77,409,923 (GRCm39) Q341L probably benign Het
Arhgef4 C T 1: 34,771,298 (GRCm39) R1202W probably benign Het
B4galnt2 C T 11: 95,766,923 (GRCm39) probably null Het
Cecr2 A T 6: 120,732,539 (GRCm39) E477V possibly damaging Het
Chmp7 A T 14: 69,956,010 (GRCm39) D419E probably benign Het
Cmip A C 8: 118,103,893 (GRCm39) K127T probably damaging Het
Csmd2 T C 4: 128,438,544 (GRCm39) V3041A probably benign Het
Cyp1b1 T A 17: 80,020,771 (GRCm39) I324F possibly damaging Het
Dapp1 T C 3: 137,638,928 (GRCm39) D225G probably benign Het
Ddx10 T C 9: 53,145,231 (GRCm39) T249A probably damaging Het
Dscaml1 T C 9: 45,361,878 (GRCm39) Y213H probably damaging Het
Eef1a2 T C 2: 180,797,150 (GRCm39) D17G probably damaging Het
Fbn1 T C 2: 125,212,069 (GRCm39) I848V probably benign Het
Fbxw18 A G 9: 109,519,585 (GRCm39) I307T probably benign Het
Fxr1 T A 3: 34,118,278 (GRCm39) D500E probably damaging Het
Gars1 G A 6: 55,046,363 (GRCm39) G492D probably damaging Het
Gria2 A T 3: 80,648,297 (GRCm39) D146E probably benign Het
Gstz1 A G 12: 87,205,894 (GRCm39) N37S probably benign Het
Hnrnph3 C A 10: 62,853,059 (GRCm39) G194V probably damaging Het
Il2rb T C 15: 78,370,600 (GRCm39) R172G possibly damaging Het
Itga11 T A 9: 62,662,578 (GRCm39) V517D possibly damaging Het
Kcnq4 A G 4: 120,561,683 (GRCm39) I462T probably benign Het
Klf6 T A 13: 5,911,639 (GRCm39) M1K probably null Het
Lrp8 G A 4: 107,718,470 (GRCm39) A817T probably benign Het
Map3k5 T A 10: 19,934,684 (GRCm39) Y509N probably damaging Het
Mdc1 C T 17: 36,163,671 (GRCm39) S1073F probably damaging Het
Mme A G 3: 63,256,133 (GRCm39) D531G possibly damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mroh7 A T 4: 106,548,821 (GRCm39) V1014E possibly damaging Het
Msantd5l A T 11: 51,144,668 (GRCm39) F204L possibly damaging Het
Myo1d C T 11: 80,557,467 (GRCm39) C491Y probably damaging Het
Ncoa3 C A 2: 165,889,799 (GRCm39) D61E probably damaging Het
Nmrk1 A G 19: 18,622,491 (GRCm39) E190G probably benign Het
Nr4a2 G T 2: 57,002,225 (GRCm39) P13H probably damaging Het
Nup205 T C 6: 35,178,943 (GRCm39) L671P probably damaging Het
Omt2a T C 9: 78,220,352 (GRCm39) I16V probably benign Het
Or4c116 A T 2: 88,942,576 (GRCm39) F93L probably damaging Het
Or51f2 T A 7: 102,526,640 (GRCm39) H104Q probably damaging Het
Or6n1 A G 1: 173,917,268 (GRCm39) I221V probably damaging Het
Or8k24 G A 2: 86,216,732 (GRCm39) T10I probably benign Het
Or8s5 G T 15: 98,238,659 (GRCm39) H70Q possibly damaging Het
Osbpl9 A T 4: 109,013,884 (GRCm39) I70N probably damaging Het
Pclo A T 5: 14,764,221 (GRCm39) L4231F unknown Het
Per1 C T 11: 68,991,444 (GRCm39) probably benign Het
Perm1 G T 4: 156,301,531 (GRCm39) C25F probably damaging Het
Phf3 A G 1: 30,844,687 (GRCm39) V1424A probably damaging Het
Plxnb1 T G 9: 108,941,096 (GRCm39) L1625R probably damaging Het
Ppid G A 3: 79,506,359 (GRCm39) V216I probably benign Het
Ppp4r3a C T 12: 101,008,175 (GRCm39) G754D probably damaging Het
Prex2 G T 1: 11,270,212 (GRCm39) W1299L probably damaging Het
Ptprn2 C A 12: 116,835,714 (GRCm39) Q350K probably benign Het
Ralyl G A 3: 14,104,850 (GRCm39) probably null Het
Rbm8a G A 3: 96,537,368 (GRCm39) probably benign Het
Relch T A 1: 105,620,004 (GRCm39) M353K probably benign Het
Ros1 A G 10: 51,977,990 (GRCm39) S1419P possibly damaging Het
Rps6ka5 C T 12: 100,564,144 (GRCm39) probably null Het
Rps6ka5 T A 12: 100,547,578 (GRCm39) I311F probably damaging Het
Rtel1 T C 2: 180,965,539 (GRCm39) probably null Het
Sacs A G 14: 61,441,722 (GRCm39) E1256G probably damaging Het
Sec23a A G 12: 59,029,372 (GRCm39) V467A probably damaging Het
Sec24d T A 3: 123,149,427 (GRCm39) N811K possibly damaging Het
Sf3b1 G A 1: 55,029,666 (GRCm39) T1112M probably damaging Het
Shisa5 T A 9: 108,885,128 (GRCm39) C133S probably null Het
Slc16a6 A G 11: 109,354,193 (GRCm39) S59P probably benign Het
Slc25a31 G A 3: 40,670,975 (GRCm39) A89T probably damaging Het
Slc6a1 G T 6: 114,284,713 (GRCm39) R257L possibly damaging Het
Sntb1 C T 15: 55,612,670 (GRCm39) V303M probably benign Het
Snx20 A G 8: 89,354,439 (GRCm39) V97A probably damaging Het
Vmn1r29 T A 6: 58,285,136 (GRCm39) N285K probably benign Het
Zfp28 A T 7: 6,392,793 (GRCm39) E156D probably damaging Het
Zfp39 A G 11: 58,793,633 (GRCm39) V35A probably benign Het
Zfp536 A C 7: 37,268,891 (GRCm39) I175S probably damaging Het
Zic5 A T 14: 122,696,969 (GRCm39) S549T unknown Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19,286,007 (GRCm39) splice site probably benign
IGL01296:Vmn2r98 APN 17 19,285,447 (GRCm39) missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19,286,020 (GRCm39) missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19,285,521 (GRCm39) missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19,286,713 (GRCm39) missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19,286,548 (GRCm39) missense probably benign
IGL02123:Vmn2r98 APN 17 19,300,941 (GRCm39) missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19,286,113 (GRCm39) missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19,286,083 (GRCm39) missense probably benign
IGL02650:Vmn2r98 APN 17 19,301,223 (GRCm39) missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19,285,521 (GRCm39) missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19,286,275 (GRCm39) missense probably benign
IGL02807:Vmn2r98 APN 17 19,301,283 (GRCm39) missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19,286,242 (GRCm39) missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19,290,107 (GRCm39) missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19,301,223 (GRCm39) missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19,286,662 (GRCm39) missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19,286,089 (GRCm39) nonsense probably null
R0545:Vmn2r98 UTSW 17 19,273,875 (GRCm39) missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19,300,759 (GRCm39) missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19,300,782 (GRCm39) missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19,301,011 (GRCm39) missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19,286,210 (GRCm39) missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19,285,440 (GRCm39) missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19,301,170 (GRCm39) missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19,286,702 (GRCm39) missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19,286,680 (GRCm39) missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19,285,595 (GRCm39) nonsense probably null
R2165:Vmn2r98 UTSW 17 19,301,553 (GRCm39) missense unknown
R2238:Vmn2r98 UTSW 17 19,286,213 (GRCm39) missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19,300,698 (GRCm39) missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19,286,081 (GRCm39) missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19,301,439 (GRCm39) missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19,287,664 (GRCm39) missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19,300,887 (GRCm39) missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19,286,354 (GRCm39) missense probably benign 0.11
R4723:Vmn2r98 UTSW 17 19,286,602 (GRCm39) missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19,286,419 (GRCm39) missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19,286,306 (GRCm39) missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19,273,815 (GRCm39) missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19,300,981 (GRCm39) missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19,290,016 (GRCm39) nonsense probably null
R5371:Vmn2r98 UTSW 17 19,290,015 (GRCm39) missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19,301,161 (GRCm39) missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19,286,260 (GRCm39) missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19,286,336 (GRCm39) missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19,286,143 (GRCm39) missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19,286,063 (GRCm39) missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19,285,510 (GRCm39) missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19,286,530 (GRCm39) missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19,301,184 (GRCm39) missense probably benign
R7068:Vmn2r98 UTSW 17 19,285,575 (GRCm39) missense probably benign
R7607:Vmn2r98 UTSW 17 19,287,570 (GRCm39) missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19,300,797 (GRCm39) missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19,287,460 (GRCm39) splice site probably null
R7915:Vmn2r98 UTSW 17 19,287,493 (GRCm39) missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19,273,912 (GRCm39) missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19,301,425 (GRCm39) missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19,301,031 (GRCm39) missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19,286,532 (GRCm39) missense probably benign
R8952:Vmn2r98 UTSW 17 19,285,531 (GRCm39) missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19,301,481 (GRCm39) missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19,286,777 (GRCm39) missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19,287,517 (GRCm39) missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19,301,496 (GRCm39) missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19,285,665 (GRCm39) missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19,287,685 (GRCm39) nonsense probably null
Z1177:Vmn2r98 UTSW 17 19,285,398 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGGCATCTTTGAATTTCTGTTAGC -3'
(R):5'- GGCTGTTTTGAACTAATTAAAGGGG -3'

Sequencing Primer
(F):5'- GAATTTCTGTTAGCTACCCCAGTAC -3'
(R):5'- TTTGAACTAATTAAAGGGGATGGTG -3'
Posted On 2015-10-21