Incidental Mutation 'R4706:Mdc1'
ID355264
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Namemediator of DNA damage checkpoint 1
SynonymsNFBD1
MMRRC Submission 041954-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R4706 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35841515-35859670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35852779 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 1073 (S1073F)
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337]
Predicted Effect probably damaging
Transcript: ENSMUST00000082337
AA Change: S1073F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: S1073F

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225192
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,279 M353K probably benign Het
Abca16 T A 7: 120,465,765 N548K probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Afap1l2 A T 19: 56,937,240 I152N possibly damaging Het
Ankrd52 T G 10: 128,378,161 M62R probably benign Het
Aox4 A T 1: 58,266,787 T1317S probably damaging Het
Apol7c T A 15: 77,525,723 Q341L probably benign Het
Arhgef4 C T 1: 34,732,217 R1202W probably benign Het
B4galnt2 C T 11: 95,876,097 probably null Het
BC049762 A T 11: 51,253,841 F204L possibly damaging Het
Cecr2 A T 6: 120,755,578 E477V possibly damaging Het
Chmp7 A T 14: 69,718,561 D419E probably benign Het
Cmip A C 8: 117,377,154 K127T probably damaging Het
Csmd2 T C 4: 128,544,751 V3041A probably benign Het
Cyp1b1 T A 17: 79,713,342 I324F possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Ddx10 T C 9: 53,233,931 T249A probably damaging Het
Dscaml1 T C 9: 45,450,580 Y213H probably damaging Het
Eef1a2 T C 2: 181,155,357 D17G probably damaging Het
Fbn1 T C 2: 125,370,149 I848V probably benign Het
Fbxw18 A G 9: 109,690,517 I307T probably benign Het
Fxr1 T A 3: 34,064,129 D500E probably damaging Het
Gars G A 6: 55,069,378 G492D probably damaging Het
Gria2 A T 3: 80,740,990 D146E probably benign Het
Gstz1 A G 12: 87,159,120 N37S probably benign Het
Hnrnph3 C A 10: 63,017,280 G194V probably damaging Het
Il2rb T C 15: 78,486,400 R172G possibly damaging Het
Itga11 T A 9: 62,755,296 V517D possibly damaging Het
Kcnq4 A G 4: 120,704,486 I462T probably benign Het
Klf6 T A 13: 5,861,640 M1K probably null Het
Lrp8 G A 4: 107,861,273 A817T probably benign Het
Map3k5 T A 10: 20,058,938 Y509N probably damaging Het
Mme A G 3: 63,348,712 D531G possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 A T 4: 106,691,624 V1014E possibly damaging Het
Myo1d C T 11: 80,666,641 C491Y probably damaging Het
Ncoa3 C A 2: 166,047,879 D61E probably damaging Het
Nmrk1 A G 19: 18,645,127 E190G probably benign Het
Nr4a2 G T 2: 57,112,213 P13H probably damaging Het
Nup205 T C 6: 35,202,008 L671P probably damaging Het
Olfr1058 G A 2: 86,386,388 T10I probably benign Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr429 A G 1: 174,089,702 I221V probably damaging Het
Olfr568 T A 7: 102,877,433 H104Q probably damaging Het
Omt2a T C 9: 78,313,070 I16V probably benign Het
Osbpl9 A T 4: 109,156,687 I70N probably damaging Het
Pclo A T 5: 14,714,207 L4231F unknown Het
Per1 C T 11: 69,100,618 probably benign Het
Perm1 G T 4: 156,217,074 C25F probably damaging Het
Phf3 A G 1: 30,805,606 V1424A probably damaging Het
Plxnb1 T G 9: 109,112,028 L1625R probably damaging Het
Ppid G A 3: 79,599,052 V216I probably benign Het
Ppp4r3a C T 12: 101,041,916 G754D probably damaging Het
Prex2 G T 1: 11,199,988 W1299L probably damaging Het
Ptprn2 C A 12: 116,872,094 Q350K probably benign Het
Ralyl G A 3: 14,039,790 probably null Het
Rbm8a G A 3: 96,630,052 probably benign Het
Ros1 A G 10: 52,101,894 S1419P possibly damaging Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Rtel1 T C 2: 181,323,746 probably null Het
Sacs A G 14: 61,204,273 E1256G probably damaging Het
Sec23a A G 12: 58,982,586 V467A probably damaging Het
Sec24d T A 3: 123,355,778 N811K possibly damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shisa5 T A 9: 109,056,060 C133S probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a31 G A 3: 40,716,545 A89T probably damaging Het
Slc6a1 G T 6: 114,307,752 R257L possibly damaging Het
Sntb1 C T 15: 55,749,274 V303M probably benign Het
Snx20 A G 8: 88,627,811 V97A probably damaging Het
Vmn1r29 T A 6: 58,308,151 N285K probably benign Het
Vmn2r98 T G 17: 19,069,745 S514R probably damaging Het
Zfp28 A T 7: 6,389,794 E156D probably damaging Het
Zfp39 A G 11: 58,902,807 V35A probably benign Het
Zfp536 A C 7: 37,569,466 I175S probably damaging Het
Zic5 A T 14: 122,459,557 S549T unknown Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 35848020 missense probably benign 0.04
IGL01662:Mdc1 APN 17 35852505 missense probably benign 0.00
IGL01931:Mdc1 APN 17 35848231 missense probably benign 0.00
IGL02542:Mdc1 APN 17 35853156 missense probably damaging 0.96
IGL02823:Mdc1 APN 17 35852923 missense probably damaging 0.99
IGL03411:Mdc1 APN 17 35853126 missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 35846191 missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 35844469 missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 35849033 missense probably benign 0.00
R0129:Mdc1 UTSW 17 35854445 missense probably benign 0.04
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0132:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1597:Mdc1 UTSW 17 35845866 missense probably damaging 1.00
R1721:Mdc1 UTSW 17 35847826 missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1912:Mdc1 UTSW 17 35844538 missense probably benign 0.00
R1912:Mdc1 UTSW 17 35850811 missense probably benign 0.19
R1977:Mdc1 UTSW 17 35850930 missense probably benign 0.01
R2121:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2122:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2357:Mdc1 UTSW 17 35847445 missense probably benign 0.00
R2842:Mdc1 UTSW 17 35848794 missense probably benign 0.01
R2851:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2852:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2964:Mdc1 UTSW 17 35853637 missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 35847893 unclassified probably benign
R3752:Mdc1 UTSW 17 35845929 missense probably damaging 1.00
R4234:Mdc1 UTSW 17 35848824 missense probably benign 0.00
R4641:Mdc1 UTSW 17 35857469 missense probably benign 0.09
R4809:Mdc1 UTSW 17 35849101 critical splice donor site probably null
R4833:Mdc1 UTSW 17 35850394 missense probably benign 0.20
R5032:Mdc1 UTSW 17 35850589 missense probably benign 0.00
R5047:Mdc1 UTSW 17 35847844 missense probably benign 0.00
R5086:Mdc1 UTSW 17 35848630 missense probably benign 0.00
R5172:Mdc1 UTSW 17 35853090 missense probably benign 0.00
R5254:Mdc1 UTSW 17 35847922 missense probably benign 0.00
R5473:Mdc1 UTSW 17 35848060 missense probably benign 0.01
R5550:Mdc1 UTSW 17 35845884 missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 35848546 missense probably benign 0.00
R5888:Mdc1 UTSW 17 35847820 missense probably benign 0.01
R6020:Mdc1 UTSW 17 35848633 missense probably benign 0.04
R6020:Mdc1 UTSW 17 35857572 missense probably benign 0.01
R6219:Mdc1 UTSW 17 35850674 missense probably benign 0.10
R7053:Mdc1 UTSW 17 35846326 missense probably benign 0.00
R7073:Mdc1 UTSW 17 35854068 missense probably benign 0.18
R7077:Mdc1 UTSW 17 35845947 missense probably damaging 0.97
R7424:Mdc1 UTSW 17 35853309 missense probably benign 0.04
R7443:Mdc1 UTSW 17 35850820 missense probably damaging 0.98
R7467:Mdc1 UTSW 17 35844556 missense probably benign 0.29
R7549:Mdc1 UTSW 17 35848857 missense probably null 0.04
R7655:Mdc1 UTSW 17 35850881 missense probably benign 0.01
R7656:Mdc1 UTSW 17 35850881 missense probably benign 0.01
R7960:Mdc1 UTSW 17 35850678 nonsense probably null
R8350:Mdc1 UTSW 17 35848299 missense probably benign 0.00
RF025:Mdc1 UTSW 17 35854407 critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 35850937 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCTGAGAGTCTTCACACAAAG -3'
(R):5'- GGGAGATTTACTTGGCCTGC -3'

Sequencing Primer
(F):5'- TGAGAGTCTTCACACAAAGCCTAATG -3'
(R):5'- ATTTACTTGGCCTGCCCCGAG -3'
Posted On2015-10-21