Incidental Mutation 'R4707:Shroom3'
ID 355309
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Name shroom family member 3
Synonyms Shrm3, D5Ertd287e, Shrm
MMRRC Submission 041955-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4707 (G1)
Quality Score 195
Status Not validated
Chromosome 5
Chromosomal Location 92831294-93113177 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 93090945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 1151 (V1151F)
Ref Sequence ENSEMBL: ENSMUSP00000153516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168878
AA Change: V1101F
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172706
SMART Domains Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201800
Predicted Effect probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,224,544 (GRCm39) K450R probably damaging Het
Abcd2 T C 15: 91,043,385 (GRCm39) D601G probably benign Het
Abcf3 A G 16: 20,367,808 (GRCm39) K56E possibly damaging Het
Acaca T C 11: 84,203,680 (GRCm39) V1477A probably damaging Het
Adamts20 G A 15: 94,231,528 (GRCm39) P887L possibly damaging Het
Ahnak T G 19: 8,994,099 (GRCm39) S5128A probably benign Het
Ahsa2 C A 11: 23,443,162 (GRCm39) V197F probably benign Het
Ak9 C A 10: 41,221,456 (GRCm39) H402N probably benign Het
Alpk1 G T 3: 127,481,241 (GRCm39) N175K possibly damaging Het
Als2 A G 1: 59,254,472 (GRCm39) V295A probably benign Het
Ankrd16 A G 2: 11,783,608 (GRCm39) D70G probably damaging Het
Apob A T 12: 8,056,205 (GRCm39) K1562N probably damaging Het
Arfgap2 C A 2: 91,100,316 (GRCm39) S250R probably damaging Het
Arhgef10l C T 4: 140,264,194 (GRCm39) M671I possibly damaging Het
Atrnl1 A G 19: 57,617,590 (GRCm39) I122V probably damaging Het
B4galnt2 C T 11: 95,766,923 (GRCm39) probably null Het
C8a A G 4: 104,713,618 (GRCm39) Y171H probably damaging Het
Cacnb4 A G 2: 52,364,927 (GRCm39) V112A probably benign Het
Capn9 G T 8: 125,340,195 (GRCm39) C566F possibly damaging Het
Ccdc88a T A 11: 29,397,956 (GRCm39) S230T probably benign Het
Cd300c2 A T 11: 114,887,811 (GRCm39) F197Y probably benign Het
Chd5 A G 4: 152,445,039 (GRCm39) Y340C probably damaging Het
Chrd A T 16: 20,557,558 (GRCm39) I726F possibly damaging Het
Chrna10 G A 7: 101,762,426 (GRCm39) P255S possibly damaging Het
Clasp1 T A 1: 118,470,927 (GRCm39) Y197* probably null Het
Cyp2c69 C G 19: 39,837,852 (GRCm39) G410A probably benign Het
Cyp2e1 G A 7: 140,343,821 (GRCm39) V20I possibly damaging Het
Dapp1 T C 3: 137,638,928 (GRCm39) D225G probably benign Het
Dnah5 A T 15: 28,372,521 (GRCm39) D2924V probably damaging Het
Efcab12 A T 6: 115,791,510 (GRCm39) L554Q possibly damaging Het
Emsy T C 7: 98,246,311 (GRCm39) T228A possibly damaging Het
Evc2 G A 5: 37,579,204 (GRCm39) V1106I probably benign Het
Exoc8 G T 8: 125,624,209 (GRCm39) Q53K possibly damaging Het
Fbn2 A T 18: 58,189,344 (GRCm39) V1594D probably damaging Het
Fer1l4 T C 2: 155,887,543 (GRCm39) Y551C possibly damaging Het
Fhip1a G T 3: 85,595,877 (GRCm39) T115K probably damaging Het
Fmnl3 A G 15: 99,221,362 (GRCm39) M481T probably benign Het
Fras1 A G 5: 96,883,097 (GRCm39) N2543S probably damaging Het
Fsd2 T C 7: 81,209,428 (GRCm39) D138G probably damaging Het
Gda C T 19: 21,405,992 (GRCm39) V5I probably benign Het
Glt8d2 A T 10: 82,496,583 (GRCm39) D158E probably damaging Het
Gpx6 C T 13: 21,496,434 (GRCm39) Q3* probably null Het
Greb1l A G 18: 10,532,922 (GRCm39) M830V probably benign Het
Hnrnpul1 A C 7: 25,426,258 (GRCm39) V531G probably damaging Het
Ifi206 A T 1: 173,308,432 (GRCm39) H521Q probably benign Het
Igsf3 G C 3: 101,365,410 (GRCm39) R1127P probably benign Het
Il1rl1 A G 1: 40,489,348 (GRCm39) R367G probably damaging Het
Islr T C 9: 58,064,970 (GRCm39) D179G possibly damaging Het
Jcad G T 18: 4,649,338 (GRCm39) E70* probably null Het
Kcnd2 T C 6: 21,723,211 (GRCm39) I467T probably benign Het
Lrrc27 A G 7: 138,822,614 (GRCm39) T502A probably benign Het
Lrrtm3 T A 10: 63,923,781 (GRCm39) H462L probably benign Het
Mbd5 T C 2: 49,140,168 (GRCm39) L44S probably damaging Het
Mccc1 C A 3: 36,030,022 (GRCm39) M429I probably damaging Het
Mgam A T 6: 40,691,566 (GRCm39) probably null Het
Mipep T A 14: 61,109,552 (GRCm39) I643N probably damaging Het
Mmrn1 A T 6: 60,965,457 (GRCm39) I1162L probably benign Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mug1 G A 6: 121,861,600 (GRCm39) C1354Y probably damaging Het
Nbeal2 A T 9: 110,461,123 (GRCm39) S1647T probably benign Het
Ndufaf2 C G 13: 108,189,314 (GRCm39) A145P probably damaging Het
Nedd9 A T 13: 41,492,051 (GRCm39) probably null Het
Nr4a2 T A 2: 57,002,105 (GRCm39) H116L probably benign Het
Nwd2 A G 5: 63,951,665 (GRCm39) Y232C probably damaging Het
Odf4 A G 11: 68,817,514 (GRCm39) L58P probably damaging Het
Or2a20 T A 6: 43,193,883 (GRCm39) V12D probably benign Het
Or4a27 T A 2: 88,559,056 (GRCm39) M296L possibly damaging Het
Or4c116 A T 2: 88,942,576 (GRCm39) F93L probably damaging Het
Or4g17 T A 2: 111,209,990 (GRCm39) L215H probably damaging Het
Or7e165 C T 9: 19,694,596 (GRCm39) H18Y probably damaging Het
Or8g24 A G 9: 38,989,558 (GRCm39) V161A probably benign Het
Or8s5 G T 15: 98,238,659 (GRCm39) H70Q possibly damaging Het
Orc6 T A 8: 86,029,579 (GRCm39) I41K probably damaging Het
Pikfyve A G 1: 65,307,005 (GRCm39) T1798A probably benign Het
Prdx6b T C 2: 80,123,404 (GRCm39) L71P probably damaging Het
Prmt2 A G 10: 76,062,055 (GRCm39) I50T probably damaging Het
Ptdss1 T C 13: 67,143,482 (GRCm39) probably null Het
Pygl T C 12: 70,254,532 (GRCm39) T138A possibly damaging Het
Rab3c T C 13: 110,198,434 (GRCm39) E198G probably benign Het
Rbl2 A G 8: 91,812,196 (GRCm39) Y255C probably damaging Het
Rev3l T A 10: 39,699,393 (GRCm39) S1297T probably damaging Het
Rgma C A 7: 73,067,564 (GRCm39) T367K probably damaging Het
Rps6ka5 C T 12: 100,564,144 (GRCm39) probably null Het
Rslcan18 A T 13: 67,246,590 (GRCm39) C217S probably damaging Het
Rtp3 A G 9: 110,815,279 (GRCm39) probably benign Het
Ryr1 A T 7: 28,745,087 (GRCm39) N3848K probably damaging Het
Sema6a T A 18: 47,381,779 (GRCm39) T923S probably benign Het
Serpinb6d A T 13: 33,855,336 (GRCm39) T337S possibly damaging Het
Sf3b1 G A 1: 55,029,666 (GRCm39) T1112M probably damaging Het
Sidt1 A T 16: 44,090,221 (GRCm39) Y369* probably null Het
Slc16a6 A G 11: 109,354,193 (GRCm39) S59P probably benign Het
Slc25a17 A C 15: 81,211,527 (GRCm39) L163W probably damaging Het
Slc44a3 T C 3: 121,320,723 (GRCm39) T93A possibly damaging Het
Sptbn1 T C 11: 30,087,197 (GRCm39) T1081A possibly damaging Het
Sptbn4 T C 7: 27,116,431 (GRCm39) D456G probably benign Het
Sycp1 C A 3: 102,760,805 (GRCm39) A703S possibly damaging Het
Tas2r118 T A 6: 23,969,225 (GRCm39) M279L probably benign Het
Tc2n T G 12: 101,660,832 (GRCm39) Q133H probably benign Het
Tctn1 A G 5: 122,399,468 (GRCm39) probably null Het
Tenm4 A C 7: 96,423,253 (GRCm39) K683Q probably damaging Het
Tex10 A T 4: 48,468,984 (GRCm39) S64T probably benign Het
Tex15 A G 8: 34,072,525 (GRCm39) T2691A probably benign Het
Tmem175 A T 5: 108,790,016 (GRCm39) T123S probably damaging Het
Tsc1 C A 2: 28,562,419 (GRCm39) S348R probably damaging Het
Ttll4 A T 1: 74,718,166 (GRCm39) T6S possibly damaging Het
Ttll8 A T 15: 88,801,293 (GRCm39) I465N probably damaging Het
Ubr3 A G 2: 69,768,714 (GRCm39) probably benign Het
Ugdh A T 5: 65,580,695 (GRCm39) probably null Het
Usp34 T C 11: 23,437,215 (GRCm39) L3326S probably damaging Het
Vmn2r125 A T 4: 156,702,276 (GRCm39) I21F probably damaging Het
Vps9d1 G A 8: 123,975,351 (GRCm39) probably benign Het
Xab2 G A 8: 3,668,117 (GRCm39) R154C possibly damaging Het
Zbtb12 T C 17: 35,114,475 (GRCm39) S87P probably damaging Het
Zc3h12a A G 4: 125,014,686 (GRCm39) M266T probably damaging Het
Zfp108 G A 7: 23,959,837 (GRCm39) A143T probably benign Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 93,098,924 (GRCm39) missense probably damaging 1.00
IGL01086:Shroom3 APN 5 93,096,311 (GRCm39) missense probably benign 0.01
IGL01363:Shroom3 APN 5 93,088,852 (GRCm39) missense probably benign 0.01
IGL01468:Shroom3 APN 5 93,088,201 (GRCm39) missense probably damaging 1.00
IGL01675:Shroom3 APN 5 93,089,539 (GRCm39) missense probably damaging 0.99
IGL01862:Shroom3 APN 5 93,110,148 (GRCm39) missense probably damaging 1.00
IGL01987:Shroom3 APN 5 93,090,048 (GRCm39) missense probably damaging 0.99
IGL02104:Shroom3 APN 5 93,088,248 (GRCm39) missense probably benign 0.32
IGL03248:Shroom3 APN 5 93,100,399 (GRCm39) missense probably benign 0.00
IGL03386:Shroom3 APN 5 93,096,342 (GRCm39) splice site probably benign
R0167:Shroom3 UTSW 5 93,096,254 (GRCm39) splice site probably benign
R0388:Shroom3 UTSW 5 93,099,152 (GRCm39) missense probably benign 0.39
R0395:Shroom3 UTSW 5 92,928,762 (GRCm39) missense probably damaging 1.00
R0567:Shroom3 UTSW 5 93,112,312 (GRCm39) missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 93,090,693 (GRCm39) missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 93,088,515 (GRCm39) missense probably damaging 0.97
R1845:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R1921:Shroom3 UTSW 5 93,110,224 (GRCm39) critical splice donor site probably null
R2059:Shroom3 UTSW 5 92,831,643 (GRCm39) missense probably damaging 1.00
R2203:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2301:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2344:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2345:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2346:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2348:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92,928,729 (GRCm39) missense probably damaging 1.00
R2435:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2829:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2830:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2831:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2897:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2898:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3080:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3433:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3729:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3730:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3735:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3852:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3943:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3969:Shroom3 UTSW 5 93,088,738 (GRCm39) missense probably benign 0.05
R4008:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4009:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4012:Shroom3 UTSW 5 93,096,342 (GRCm39) splice site probably benign
R4154:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4157:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4172:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4173:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4201:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4202:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4206:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4284:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4285:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4364:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4384:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4456:Shroom3 UTSW 5 93,088,858 (GRCm39) missense probably benign 0.14
R4712:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4751:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4755:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4760:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4773:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4774:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4776:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4801:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4802:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4856:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4857:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4882:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4883:Shroom3 UTSW 5 93,098,993 (GRCm39) missense probably benign 0.14
R4886:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R5262:Shroom3 UTSW 5 93,112,432 (GRCm39) missense probably damaging 1.00
R5271:Shroom3 UTSW 5 93,110,107 (GRCm39) missense probably damaging 1.00
R5719:Shroom3 UTSW 5 93,090,877 (GRCm39) missense probably benign 0.04
R5726:Shroom3 UTSW 5 93,090,864 (GRCm39) missense probably benign 0.00
R5993:Shroom3 UTSW 5 93,088,047 (GRCm39) missense probably damaging 1.00
R6078:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6138:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6153:Shroom3 UTSW 5 93,112,267 (GRCm39) missense probably damaging 0.99
R6493:Shroom3 UTSW 5 93,089,420 (GRCm39) missense probably benign 0.03
R6495:Shroom3 UTSW 5 93,089,928 (GRCm39) missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 93,088,617 (GRCm39) missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 93,088,795 (GRCm39) missense probably damaging 1.00
R6893:Shroom3 UTSW 5 93,090,063 (GRCm39) missense probably damaging 0.97
R6912:Shroom3 UTSW 5 93,090,876 (GRCm39) missense probably benign 0.02
R6924:Shroom3 UTSW 5 93,112,262 (GRCm39) missense probably damaging 1.00
R7083:Shroom3 UTSW 5 93,112,384 (GRCm39) missense probably damaging 1.00
R7197:Shroom3 UTSW 5 93,090,463 (GRCm39) missense probably damaging 1.00
R7366:Shroom3 UTSW 5 93,112,465 (GRCm39) nonsense probably null
R7712:Shroom3 UTSW 5 93,098,806 (GRCm39) missense probably benign 0.01
R7725:Shroom3 UTSW 5 93,089,512 (GRCm39) missense probably benign 0.19
R7728:Shroom3 UTSW 5 92,831,566 (GRCm39) missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 93,098,348 (GRCm39) missense probably damaging 0.98
R7795:Shroom3 UTSW 5 93,067,508 (GRCm39) missense probably damaging 0.99
R7821:Shroom3 UTSW 5 93,088,705 (GRCm39) missense probably damaging 0.98
R7971:Shroom3 UTSW 5 93,098,933 (GRCm39) missense probably damaging 1.00
R8276:Shroom3 UTSW 5 93,088,339 (GRCm39) missense probably damaging 0.99
R8934:Shroom3 UTSW 5 93,089,584 (GRCm39) missense probably damaging 1.00
R8938:Shroom3 UTSW 5 93,090,930 (GRCm39) missense probably damaging 1.00
R9083:Shroom3 UTSW 5 93,098,533 (GRCm39) missense probably damaging 0.97
R9108:Shroom3 UTSW 5 93,087,975 (GRCm39) missense probably damaging 1.00
R9124:Shroom3 UTSW 5 93,112,401 (GRCm39) missense probably benign 0.19
R9295:Shroom3 UTSW 5 93,098,478 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- GTCTTAACTGTCAGAACGGTAAC -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- TTAACTGTCAGAACGGTAACCAACC -3'
Posted On 2015-10-21