Mutagenetix > Incidental Mutation

Incidental Mutation 'R4707:Ryr1'

355320

Institutional Source

Beutler Lab

Gene Symbol

Ryr1

Ensembl Gene

ENSMUSG00000030592

Gene Name

ryanodine receptor 1, skeletal muscle

Synonyms

skrr, calcium release channel isoform 1, Ryr

MMRRC Submission

041955-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4707 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29003344-29125179 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 29045662 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 3848 (N3848K)

Ref Sequence

ENSEMBL: ENSMUSP00000137123 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000032813
AA Change: N3846K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: N3846K

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	441	645	1.2e-73	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	851	945	6.5e-33	PFAM
Pfam:RyR	965	1059	1.5e-30	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2158	2366	7e-66	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2735	2829	9.7e-34	PFAM
Pfam:RyR	2855	2943	5.7e-32	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3613	3642	2e-13	PDB
low complexity region	3681	3691	N/A	INTRINSIC
low complexity region	3735	3760	N/A	INTRINSIC
Pfam:RIH_assoc	3872	4004	1.9e-41	PFAM
low complexity region	4010	4023	N/A	INTRINSIC
Pfam:EF-hand_8	4085	4136	9.8e-8	PFAM
transmembrane domain	4283	4305	N/A	INTRINSIC
transmembrane domain	4318	4336	N/A	INTRINSIC
transmembrane domain	4341	4363	N/A	INTRINSIC
Pfam:RR_TM4-6	4377	4666	2e-86	PFAM
Pfam:Ion_trans	4761	4932	3.4e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000179893
AA Change: N3848K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: N3848K

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	443	638	4.5e-63	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	852	942	1.3e-37	PFAM
Pfam:RyR	966	1056	1.6e-28	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2160	2366	2.2e-68	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2736	2826	7.2e-31	PFAM
Pfam:RyR	2856	2940	5.6e-27	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3615	3644	2e-13	PDB
low complexity region	3683	3693	N/A	INTRINSIC
low complexity region	3737	3762	N/A	INTRINSIC
Pfam:RIH_assoc	3878	3996	6.2e-35	PFAM
low complexity region	4012	4025	N/A	INTRINSIC
Pfam:EF-hand_8	4087	4137	1.8e-8	PFAM
transmembrane domain	4285	4307	N/A	INTRINSIC
transmembrane domain	4320	4338	N/A	INTRINSIC
transmembrane domain	4343	4365	N/A	INTRINSIC
Pfam:RR_TM4-6	4379	4668	8.4e-76	PFAM
Pfam:Ion_trans	4763	4946	2.8e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200205

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208010

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208318

Predicted Effect

probably damaging
Transcript: ENSMUST00000214374
AA Change: N3855K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	A	G	17: 9,005,712	K450R	probably damaging	Het
Abcd2	T	C	15: 91,159,182	D601G	probably benign	Het
Abcf3	A	G	16: 20,549,058	K56E	possibly damaging	Het
Acaca	T	C	11: 84,312,854	V1477A	probably damaging	Het
Adamts20	G	A	15: 94,333,647	P887L	possibly damaging	Het
Ahnak	T	G	19: 9,016,735	S5128A	probably benign	Het
Ahsa2	C	A	11: 23,493,162	V197F	probably benign	Het
Ak9	C	A	10: 41,345,460	H402N	probably benign	Het
Alpk1	G	T	3: 127,687,592	N175K	possibly damaging	Het
Als2	A	G	1: 59,215,313	V295A	probably benign	Het
Ankrd16	A	G	2: 11,778,797	D70G	probably damaging	Het
Apob	A	T	12: 8,006,205	K1562N	probably damaging	Het
Arfgap2	C	A	2: 91,269,971	S250R	probably damaging	Het
Arhgef10l	C	T	4: 140,536,883	M671I	possibly damaging	Het
Atrnl1	A	G	19: 57,629,158	I122V	probably damaging	Het
B4galnt2	C	T	11: 95,876,097		probably null	Het
C8a	A	G	4: 104,856,421	Y171H	probably damaging	Het
Cacnb4	A	G	2: 52,474,915	V112A	probably benign	Het
Capn9	G	T	8: 124,613,456	C566F	possibly damaging	Het
Ccdc88a	T	A	11: 29,447,956	S230T	probably benign	Het
Cd300c2	A	T	11: 114,996,985	F197Y	probably benign	Het
Chd5	A	G	4: 152,360,582	Y340C	probably damaging	Het
Chrd	A	T	16: 20,738,808	I726F	possibly damaging	Het
Chrna10	G	A	7: 102,113,219	P255S	possibly damaging	Het
Clasp1	T	A	1: 118,543,197	Y197*	probably null	Het
Cyp2c69	C	G	19: 39,849,408	G410A	probably benign	Het
Cyp2e1	G	A	7: 140,763,908	V20I	possibly damaging	Het
Dapp1	T	C	3: 137,933,167	D225G	probably benign	Het
Dnah5	A	T	15: 28,372,375	D2924V	probably damaging	Het
Efcab12	A	T	6: 115,814,549	L554Q	possibly damaging	Het
Emsy	T	C	7: 98,597,104	T228A	possibly damaging	Het
Evc2	G	A	5: 37,421,860	V1106I	probably benign	Het
Exoc8	G	T	8: 124,897,470	Q53K	possibly damaging	Het
Fam160a1	G	T	3: 85,688,570	T115K	probably damaging	Het
Fbn2	A	T	18: 58,056,272	V1594D	probably damaging	Het
Fer1l4	T	C	2: 156,045,623	Y551C	possibly damaging	Het
Fmnl3	A	G	15: 99,323,481	M481T	probably benign	Het
Fras1	A	G	5: 96,735,238	N2543S	probably damaging	Het
Fsd2	T	C	7: 81,559,680	D138G	probably damaging	Het
Gda	C	T	19: 21,428,628	V5I	probably benign	Het
Glt8d2	A	T	10: 82,660,749	D158E	probably damaging	Het
Gpx6	C	T	13: 21,312,264	Q3*	probably null	Het
Greb1l	A	G	18: 10,532,922	M830V	probably benign	Het
Hnrnpul1	A	C	7: 25,726,833	V531G	probably damaging	Het
Ifi206	A	T	1: 173,480,866	H521Q	probably benign	Het
Igsf3	G	C	3: 101,458,094	R1127P	probably benign	Het
Il1rl1	A	G	1: 40,450,188	R367G	probably damaging	Het
Islr	T	C	9: 58,157,687	D179G	possibly damaging	Het
Jcad	G	T	18: 4,649,338	E70*	probably null	Het
Kcnd2	T	C	6: 21,723,212	I467T	probably benign	Het
Lrrc27	A	G	7: 139,242,698	T502A	probably benign	Het
Lrrtm3	T	A	10: 64,088,002	H462L	probably benign	Het
Mbd5	T	C	2: 49,250,156	L44S	probably damaging	Het
Mccc1	C	A	3: 35,975,873	M429I	probably damaging	Het
Mgam	A	T	6: 40,714,632		probably null	Het
Mipep	T	A	14: 60,872,103	I643N	probably damaging	Het
Mmrn1	A	T	6: 60,988,473	I1162L	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mug1	G	A	6: 121,884,641	C1354Y	probably damaging	Het
Nbeal2	A	T	9: 110,632,055	S1647T	probably benign	Het
Ndufaf2	C	G	13: 108,052,780	A145P	probably damaging	Het
Nedd9	A	T	13: 41,338,575		probably null	Het
Nr4a2	T	A	2: 57,112,093	H116L	probably benign	Het
Nwd2	A	G	5: 63,794,322	Y232C	probably damaging	Het
Odf4	A	G	11: 68,926,688	L58P	probably damaging	Het
Olfr1197	T	A	2: 88,728,712	M296L	possibly damaging	Het
Olfr1221	A	T	2: 89,112,232	F93L	probably damaging	Het
Olfr1284	T	A	2: 111,379,645	L215H	probably damaging	Het
Olfr284	G	T	15: 98,340,778	H70Q	possibly damaging	Het
Olfr434	T	A	6: 43,216,949	V12D	probably benign	Het
Olfr58	C	T	9: 19,783,300	H18Y	probably damaging	Het
Olfr938	A	G	9: 39,078,262	V161A	probably benign	Het
Orc6	T	A	8: 85,302,950	I41K	probably damaging	Het
Pikfyve	A	G	1: 65,267,846	T1798A	probably benign	Het
Prdx6b	T	C	2: 80,293,060	L71P	probably damaging	Het
Prmt2	A	G	10: 76,226,221	I50T	probably damaging	Het
Ptdss1	T	C	13: 66,995,418		probably null	Het
Pygl	T	C	12: 70,207,758	T138A	possibly damaging	Het
Rab3c	T	C	13: 110,061,900	E198G	probably benign	Het
Rbl2	A	G	8: 91,085,568	Y255C	probably damaging	Het
Rev3l	T	A	10: 39,823,397	S1297T	probably damaging	Het
Rgma	C	A	7: 73,417,816	T367K	probably damaging	Het
Rps6ka5	C	T	12: 100,597,885		probably null	Het
Rslcan18	A	T	13: 67,098,526	C217S	probably damaging	Het
Rtp3	A	G	9: 110,986,211		probably benign	Het
Sema6a	T	A	18: 47,248,712	T923S	probably benign	Het
Serpinb6d	A	T	13: 33,671,353	T337S	possibly damaging	Het
Sf3b1	G	A	1: 54,990,507	T1112M	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sidt1	A	T	16: 44,269,858	Y369*	probably null	Het
Slc16a6	A	G	11: 109,463,367	S59P	probably benign	Het
Slc25a17	A	C	15: 81,327,326	L163W	probably damaging	Het
Slc44a3	T	C	3: 121,527,074	T93A	possibly damaging	Het
Sptbn1	T	C	11: 30,137,197	T1081A	possibly damaging	Het
Sptbn4	T	C	7: 27,417,006	D456G	probably benign	Het
Sycp1	C	A	3: 102,853,489	A703S	possibly damaging	Het
Tas2r118	T	A	6: 23,969,226	M279L	probably benign	Het
Tc2n	T	G	12: 101,694,573	Q133H	probably benign	Het
Tctn1	A	G	5: 122,261,405		probably null	Het
Tenm4	A	C	7: 96,774,046	K683Q	probably damaging	Het
Tex10	A	T	4: 48,468,984	S64T	probably benign	Het
Tex15	A	G	8: 33,582,497	T2691A	probably benign	Het
Tmem175	A	T	5: 108,642,150	T123S	probably damaging	Het
Tsc1	C	A	2: 28,672,407	S348R	probably damaging	Het
Ttll4	A	T	1: 74,679,007	T6S	possibly damaging	Het
Ttll8	A	T	15: 88,917,090	I465N	probably damaging	Het
Ubr3	A	G	2: 69,938,370		probably benign	Het
Ugdh	A	T	5: 65,423,352		probably null	Het
Usp34	T	C	11: 23,487,215	L3326S	probably damaging	Het
Vmn2r125	A	T	4: 156,349,981	I21F	probably damaging	Het
Vps9d1	G	A	8: 123,248,612		probably benign	Het
Xab2	G	A	8: 3,618,117	R154C	possibly damaging	Het
Zbtb12	T	C	17: 34,895,499	S87P	probably damaging	Het
Zc3h12a	A	G	4: 125,120,893	M266T	probably damaging	Het
Zfp108	G	A	7: 24,260,412	A143T	probably benign	Het

Other mutations in Ryr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ryr1	APN	7	29102810	missense	probably damaging	1.00
IGL00335:Ryr1	APN	7	29124960	splice site	probably null
IGL00427:Ryr1	APN	7	29104737	splice site	probably benign
IGL00559:Ryr1	APN	7	29012242	splice site	probably benign
IGL00803:Ryr1	APN	7	29069645	missense	possibly damaging	0.95
IGL00886:Ryr1	APN	7	29024229	missense	probably damaging	1.00
IGL00948:Ryr1	APN	7	29020195	missense	possibly damaging	0.78
IGL01017:Ryr1	APN	7	29082543	missense	probably damaging	0.99
IGL01116:Ryr1	APN	7	29100202	splice site	probably benign
IGL01385:Ryr1	APN	7	29056985	missense	probably damaging	1.00
IGL01482:Ryr1	APN	7	29052337	missense	probably damaging	1.00
IGL01529:Ryr1	APN	7	29075227	missense	probably damaging	1.00
IGL01543:Ryr1	APN	7	29091076	missense	probably damaging	1.00
IGL01653:Ryr1	APN	7	29078597	missense	probably damaging	0.99
IGL01701:Ryr1	APN	7	29059810	missense	probably damaging	0.98
IGL02051:Ryr1	APN	7	29071658	missense	probably benign	0.16
IGL02152:Ryr1	APN	7	29052015	missense	possibly damaging	0.95
IGL02271:Ryr1	APN	7	29094047	missense	probably benign	0.07
IGL02321:Ryr1	APN	7	29078696	missense	probably damaging	1.00
IGL02448:Ryr1	APN	7	29105066	splice site	probably benign
IGL02472:Ryr1	APN	7	29040844	missense	probably damaging	1.00
IGL02544:Ryr1	APN	7	29115599	missense	probably benign	0.24
IGL02666:Ryr1	APN	7	29019763	missense	unknown
IGL02672:Ryr1	APN	7	29004519	unclassified	probably benign
IGL02677:Ryr1	APN	7	29110608	missense	probably benign	0.18
IGL02686:Ryr1	APN	7	29069550	splice site	probably benign
IGL02751:Ryr1	APN	7	29078774	missense	probably damaging	1.00
IGL02899:Ryr1	APN	7	29048795	missense	possibly damaging	0.53
IGL02926:Ryr1	APN	7	29061540	missense	probably damaging	1.00
IGL02950:Ryr1	APN	7	29097459	missense	probably damaging	1.00
IGL02960:Ryr1	APN	7	29060053	missense	probably damaging	1.00
IGL02968:Ryr1	APN	7	29043893	missense	probably damaging	1.00
IGL03070:Ryr1	APN	7	29070659	missense	probably damaging	1.00
IGL03091:Ryr1	APN	7	29083486	missense	possibly damaging	0.85
IGL03100:Ryr1	APN	7	29104593	missense	probably damaging	1.00
IGL03107:Ryr1	APN	7	29075199	missense	probably damaging	1.00
IGL03117:Ryr1	APN	7	29102964	missense	probably damaging	1.00
IGL03118:Ryr1	APN	7	29015786	missense	unknown
IGL03146:Ryr1	APN	7	29094032	missense	probably benign	0.09
IGL03165:Ryr1	APN	7	29105040	missense	probably benign	0.22
IGL03220:Ryr1	APN	7	29059855	missense	probably damaging	1.00
R0017:Ryr1	UTSW	7	29047542	missense	probably damaging	1.00
R0066:Ryr1	UTSW	7	29005567	unclassified	probably benign
R0066:Ryr1	UTSW	7	29005567	unclassified	probably benign
R0069:Ryr1	UTSW	7	29110505	splice site	probably benign
R0148:Ryr1	UTSW	7	29052035	missense	probably damaging	0.99
R0266:Ryr1	UTSW	7	29040679	missense	probably damaging	1.00
R0346:Ryr1	UTSW	7	29067588	splice site	probably benign
R0387:Ryr1	UTSW	7	29083367	splice site	probably benign
R0454:Ryr1	UTSW	7	29036075	missense	probably damaging	0.99
R0494:Ryr1	UTSW	7	29003793	splice site	probably benign
R0533:Ryr1	UTSW	7	29078780	missense	probably damaging	1.00
R0585:Ryr1	UTSW	7	29036076	missense	probably damaging	1.00
R0591:Ryr1	UTSW	7	29104795	missense	possibly damaging	0.68
R0624:Ryr1	UTSW	7	29074609	missense	probably damaging	1.00
R0662:Ryr1	UTSW	7	29100189	missense	probably damaging	1.00
R0849:Ryr1	UTSW	7	29040679	missense	probably damaging	1.00
R0961:Ryr1	UTSW	7	29009697	missense	unknown
R1052:Ryr1	UTSW	7	29096258	missense	probably damaging	0.96
R1218:Ryr1	UTSW	7	29086109	missense	possibly damaging	0.79
R1340:Ryr1	UTSW	7	29116012	missense	probably damaging	0.99
R1513:Ryr1	UTSW	7	29070621	missense	probably damaging	1.00
R1543:Ryr1	UTSW	7	29083537	missense	possibly damaging	0.67
R1566:Ryr1	UTSW	7	29092175	missense	possibly damaging	0.95
R1572:Ryr1	UTSW	7	29062191	missense	probably damaging	1.00
R1623:Ryr1	UTSW	7	29095490	missense	probably damaging	1.00
R1632:Ryr1	UTSW	7	29094261	missense	probably benign	0.03
R1661:Ryr1	UTSW	7	29101738	missense	probably damaging	0.98
R1665:Ryr1	UTSW	7	29036078	missense	probably damaging	1.00
R1678:Ryr1	UTSW	7	29116154	missense	probably damaging	0.99
R1705:Ryr1	UTSW	7	29078564	missense	probably damaging	1.00
R1712:Ryr1	UTSW	7	29047503	missense	probably benign	0.25
R1720:Ryr1	UTSW	7	29101870	missense	probably damaging	0.99
R1799:Ryr1	UTSW	7	29067621	missense	probably damaging	1.00
R1847:Ryr1	UTSW	7	29079811	missense	probably benign	0.43
R1860:Ryr1	UTSW	7	29009552	missense	unknown
R1861:Ryr1	UTSW	7	29009552	missense	unknown
R1921:Ryr1	UTSW	7	29054944	missense	probably damaging	1.00
R1983:Ryr1	UTSW	7	29059472	missense	possibly damaging	0.74
R2043:Ryr1	UTSW	7	29059631	missense	probably damaging	0.99
R2089:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2105:Ryr1	UTSW	7	29090150	missense	probably damaging	0.99
R2175:Ryr1	UTSW	7	29068442	missense	probably damaging	1.00
R2259:Ryr1	UTSW	7	29019741	missense	unknown
R2291:Ryr1	UTSW	7	29098777	missense	probably damaging	1.00
R2351:Ryr1	UTSW	7	29075293	missense	probably benign	0.18
R2512:Ryr1	UTSW	7	29103542	missense	possibly damaging	0.64
R2571:Ryr1	UTSW	7	29009562	missense	unknown
R2571:Ryr1	UTSW	7	29036126	missense	possibly damaging	0.94
R2885:Ryr1	UTSW	7	29074798	missense	probably damaging	0.99
R2886:Ryr1	UTSW	7	29074798	missense	probably damaging	0.99
R2889:Ryr1	UTSW	7	29078741	missense	possibly damaging	0.76
R3051:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3052:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3053:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3082:Ryr1	UTSW	7	29045646	missense	probably damaging	1.00
R3103:Ryr1	UTSW	7	29074948	missense	probably damaging	1.00
R3237:Ryr1	UTSW	7	29069650	critical splice acceptor site	probably null
R3551:Ryr1	UTSW	7	29056997	missense	probably damaging	1.00
R3552:Ryr1	UTSW	7	29056997	missense	probably damaging	1.00
R3807:Ryr1	UTSW	7	29020152	missense	probably damaging	1.00
R3815:Ryr1	UTSW	7	29072902	missense	probably damaging	0.98
R4010:Ryr1	UTSW	7	29095124	missense	probably benign	0.41
R4041:Ryr1	UTSW	7	29085931	missense	possibly damaging	0.77
R4226:Ryr1	UTSW	7	29062151	nonsense	probably null
R4257:Ryr1	UTSW	7	29082450	missense	possibly damaging	0.93
R4328:Ryr1	UTSW	7	29083059	missense	probably damaging	1.00
R4394:Ryr1	UTSW	7	29094242	missense	possibly damaging	0.69
R4485:Ryr1	UTSW	7	29090156	missense	probably damaging	0.97
R4550:Ryr1	UTSW	7	29098735	missense	probably benign	0.05
R4554:Ryr1	UTSW	7	29105008	missense	probably benign	0.03
R4562:Ryr1	UTSW	7	29074580	intron	probably benign
R4642:Ryr1	UTSW	7	29086038	missense	possibly damaging	0.91
R4669:Ryr1	UTSW	7	29059831	missense	probably null	0.99
R4766:Ryr1	UTSW	7	29085833	missense	probably damaging	0.96
R4768:Ryr1	UTSW	7	29004821	unclassified	probably benign
R4770:Ryr1	UTSW	7	29109282	missense	probably damaging	0.99
R4780:Ryr1	UTSW	7	29095097	missense	possibly damaging	0.85
R4927:Ryr1	UTSW	7	29019983	missense	unknown
R4933:Ryr1	UTSW	7	29104298	missense	probably damaging	1.00
R4934:Ryr1	UTSW	7	29068095	missense	probably damaging	1.00
R4942:Ryr1	UTSW	7	29069573	missense	probably damaging	0.98
R4960:Ryr1	UTSW	7	29078783	missense	possibly damaging	0.82
R5007:Ryr1	UTSW	7	29069115	missense	probably damaging	1.00
R5011:Ryr1	UTSW	7	29102809	splice site	probably null
R5013:Ryr1	UTSW	7	29102809	splice site	probably null
R5137:Ryr1	UTSW	7	29101858	missense	possibly damaging	0.94
R5167:Ryr1	UTSW	7	29067693	missense	probably damaging	1.00
R5239:Ryr1	UTSW	7	29036128	missense	probably damaging	1.00
R5291:Ryr1	UTSW	7	29115598	missense	probably benign	0.03
R5303:Ryr1	UTSW	7	29068482	missense	probably damaging	1.00
R5386:Ryr1	UTSW	7	29117416	missense	probably damaging	0.98
R5431:Ryr1	UTSW	7	29109812	missense	probably benign	0.39
R5460:Ryr1	UTSW	7	29071961	missense	probably damaging	1.00
R5463:Ryr1	UTSW	7	29024023	missense	possibly damaging	0.79
R5503:Ryr1	UTSW	7	29069028	missense	possibly damaging	0.87
R5541:Ryr1	UTSW	7	29086185	missense	probably damaging	1.00
R5573:Ryr1	UTSW	7	29015723	missense	unknown
R5575:Ryr1	UTSW	7	29078693	missense	possibly damaging	0.77
R5610:Ryr1	UTSW	7	29111974	missense	probably benign	0.05
R5658:Ryr1	UTSW	7	29091089	splice site	probably null
R5918:Ryr1	UTSW	7	29009152	missense	probably benign	0.39
R5926:Ryr1	UTSW	7	29104360	missense	probably damaging	1.00
R5938:Ryr1	UTSW	7	29046865	missense	probably damaging	1.00
R5939:Ryr1	UTSW	7	29116127	missense	probably damaging	0.97
R5947:Ryr1	UTSW	7	29071924	missense	probably null	0.98
R5991:Ryr1	UTSW	7	29104610	missense	probably damaging	0.99
R5992:Ryr1	UTSW	7	29067637	missense	probably damaging	1.00
R5996:Ryr1	UTSW	7	29024241	missense	probably benign	0.38
R6075:Ryr1	UTSW	7	29087438	missense	probably damaging	1.00
R6091:Ryr1	UTSW	7	29071973	missense	probably benign	0.01
R6126:Ryr1	UTSW	7	29076239	missense	probably null	1.00
R6147:Ryr1	UTSW	7	29085914	missense	possibly damaging	0.88
R6235:Ryr1	UTSW	7	29116181	missense	probably benign	0.07
R6279:Ryr1	UTSW	7	29087428	missense	possibly damaging	0.93
R6381:Ryr1	UTSW	7	29075257	missense	possibly damaging	0.87
R6441:Ryr1	UTSW	7	29059695	missense	possibly damaging	0.95
R6443:Ryr1	UTSW	7	29077078	missense	probably damaging	0.97
R6459:Ryr1	UTSW	7	29015654	missense	probably benign	0.39
R6514:Ryr1	UTSW	7	29046841	missense	probably damaging	1.00
R6563:Ryr1	UTSW	7	29095492	missense	possibly damaging	0.92
R6660:Ryr1	UTSW	7	29038345	critical splice donor site	probably null
R6746:Ryr1	UTSW	7	29117404	missense	possibly damaging	0.56
R6785:Ryr1	UTSW	7	29064874	missense	probably benign	0.12
R6800:Ryr1	UTSW	7	29024316	missense	possibly damaging	0.95
R6939:Ryr1	UTSW	7	29052326	missense	possibly damaging	0.91
R6980:Ryr1	UTSW	7	29109387	missense	probably benign	0.03
R6995:Ryr1	UTSW	7	29094182	missense	probably damaging	0.97
R7065:Ryr1	UTSW	7	29103643	missense	probably damaging	1.00
R7123:Ryr1	UTSW	7	29046854	missense	probably benign	0.37
R7238:Ryr1	UTSW	7	29095382	missense	probably benign	0.24
R7240:Ryr1	UTSW	7	29052015	missense	possibly damaging	0.95
R7300:Ryr1	UTSW	7	29059511	missense	probably damaging	1.00
R7365:Ryr1	UTSW	7	29085755	missense	probably benign	0.05
R7403:Ryr1	UTSW	7	29013867	missense	probably benign	0.34
R7422:Ryr1	UTSW	7	29085870	missense	probably benign	0.00
R7493:Ryr1	UTSW	7	29095205	missense	probably benign	0.44
R7570:Ryr1	UTSW	7	29078585	missense	probably damaging	0.98
R7593:Ryr1	UTSW	7	29036103	missense	probably damaging	1.00
R7769:Ryr1	UTSW	7	29098785	missense	probably damaging	1.00
R7781:Ryr1	UTSW	7	29067630	missense	probably damaging	1.00
R7790:Ryr1	UTSW	7	29104832	missense	probably benign	0.39
R7799:Ryr1	UTSW	7	29003560	splice site	probably null
R7916:Ryr1	UTSW	7	29090939	nonsense	probably null
R7922:Ryr1	UTSW	7	29097224	missense	probably benign	0.09
R7988:Ryr1	UTSW	7	29096171	missense	probably benign	0.29
R7997:Ryr1	UTSW	7	29003543	missense	unknown
R8052:Ryr1	UTSW	7	29083385	missense	probably benign	0.05
R8096:Ryr1	UTSW	7	29009201	missense	unknown
R8116:Ryr1	UTSW	7	29110883	missense	probably benign	0.03
R8202:Ryr1	UTSW	7	29091032	missense	probably benign	0.18
R8207:Ryr1	UTSW	7	29090225	missense	probably damaging	1.00
R8248:Ryr1	UTSW	7	29069121	missense	probably damaging	1.00
R8257:Ryr1	UTSW	7	29064639	missense	possibly damaging	0.82
R8354:Ryr1	UTSW	7	29015717	missense	unknown
R8454:Ryr1	UTSW	7	29015717	missense	unknown
R8487:Ryr1	UTSW	7	29040867	missense	probably damaging	0.97
R8529:Ryr1	UTSW	7	29070084	missense	possibly damaging	0.86
R8545:Ryr1	UTSW	7	29004814	unclassified	probably benign
R8678:Ryr1	UTSW	7	29077064	missense	probably damaging	0.99
R8717:Ryr1	UTSW	7	29052328	missense	probably benign	0.03
R8724:Ryr1	UTSW	7	29117377	missense	probably benign	0.04
R8755:Ryr1	UTSW	7	29092268	missense	probably benign	0.19
R8772:Ryr1	UTSW	7	29116132	missense	probably benign	0.05
R8790:Ryr1	UTSW	7	29076872	missense	probably damaging	1.00
R8793:Ryr1	UTSW	7	29064859	missense	probably damaging	1.00
R8836:Ryr1	UTSW	7	29074666	missense	probably damaging	1.00
R8858:Ryr1	UTSW	7	29109213	missense	probably benign	0.00
R8910:Ryr1	UTSW	7	29071915	missense	probably damaging	1.00
R8920:Ryr1	UTSW	7	29090215	missense	possibly damaging	0.89
R8938:Ryr1	UTSW	7	29101933	missense	probably damaging	1.00
R9035:Ryr1	UTSW	7	29090997	missense	probably damaging	0.97
R9115:Ryr1	UTSW	7	29104564	nonsense	probably null
R9123:Ryr1	UTSW	7	29071804	missense	probably damaging	1.00
R9154:Ryr1	UTSW	7	29069858	missense	probably benign	0.08
R9189:Ryr1	UTSW	7	29077046	missense	probably damaging	1.00
R9200:Ryr1	UTSW	7	29095099	missense	probably benign	0.00
R9214:Ryr1	UTSW	7	29085762	missense	possibly damaging	0.52
R9216:Ryr1	UTSW	7	29101852	missense	probably damaging	0.97
R9240:Ryr1	UTSW	7	29043888	missense	probably damaging	1.00
R9261:Ryr1	UTSW	7	29052388	missense	possibly damaging	0.91
R9276:Ryr1	UTSW	7	29102829	missense	probably damaging	0.99
R9280:Ryr1	UTSW	7	29102964	missense	probably damaging	1.00
R9316:Ryr1	UTSW	7	29017962	missense	unknown
R9333:Ryr1	UTSW	7	29074789	critical splice donor site	probably null
R9459:Ryr1	UTSW	7	29068643	missense	probably damaging	1.00
R9468:Ryr1	UTSW	7	29073085	missense	probably damaging	1.00
R9486:Ryr1	UTSW	7	29078540	missense	probably benign	0.15
R9524:Ryr1	UTSW	7	29024175	missense	probably damaging	1.00
R9620:Ryr1	UTSW	7	29015713	missense	unknown
R9664:Ryr1	UTSW	7	29059667	missense	probably damaging	1.00
R9776:Ryr1	UTSW	7	29075239	missense	probably damaging	1.00
X0021:Ryr1	UTSW	7	29061531	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	29020214	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	29086035	missense	probably benign	0.10
Z1176:Ryr1	UTSW	7	29103498	missense	probably damaging	1.00
Z1177:Ryr1	UTSW	7	29017985	missense	unknown
Z1177:Ryr1	UTSW	7	29048792	nonsense	probably null
Z1177:Ryr1	UTSW	7	29101922	missense	probably damaging	1.00
Z1186:Ryr1	UTSW	7	29082477	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- TTAGGACCGGGAATCACAACC -3'
(R):5'- GGCTGGAATGGTGTCTACAG -3'

Sequencing Primer
(F):5'- CTGAGGGAACTCTTGAGA -3'
(R):5'- TCTACAGAAGACGAGAGGTGG -3'

Posted On

2015-10-21