Mutagenetix > Incidental Mutation

Incidental Mutation 'R4707:Tenm4'

355324

Institutional Source

Beutler Lab

Gene Symbol

Tenm4

Ensembl Gene

ENSMUSG00000048078

Gene Name

teneurin transmembrane protein 4

Synonyms

Doc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4

MMRRC Submission

041955-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4707 (G1)

Quality Score

223

Status

Not validated

Chromosome

Chromosomal Location

96171246-96911093 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 96774046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 683 (K683Q)

Ref Sequence

ENSEMBL: ENSMUSP00000102783 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000107162
AA Change: K691Q

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: K691Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	410	5.6e-195	PFAM
transmembrane domain	411	433	N/A	INTRINSIC
EGF_like	637	665	3.43e1	SMART
EGF	668	696	2.29e1	SMART
EGF	701	730	1.88e-1	SMART
EGF	733	762	1.13e1	SMART
EGF	767	797	2.39e1	SMART
EGF	800	828	4.32e-1	SMART
EGF	831	859	6.02e0	SMART
EGF	862	894	9.93e-1	SMART
low complexity region	900	914	N/A	INTRINSIC
Pfam:RHS_repeat	2327	2380	5.5e-7	PFAM
Pfam:Tox-GHH	2740	2818	5.2e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107165
AA Change: K683Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: K683Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	36	402	1.1e-171	PFAM
transmembrane domain	403	425	N/A	INTRINSIC
EGF_like	629	657	3.43e1	SMART
EGF	660	688	2.29e1	SMART
EGF	693	722	1.88e-1	SMART
EGF	725	754	1.13e1	SMART
EGF	759	789	2.39e1	SMART
EGF	792	820	4.32e-1	SMART
EGF	823	851	6.02e0	SMART
EGF	863	895	9.93e-1	SMART
low complexity region	901	915	N/A	INTRINSIC
Pfam:RHS_repeat	2335	2368	1.6e-7	PFAM
Pfam:Tox-GHH	2749	2826	1.8e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107166
AA Change: K646Q

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: K646Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	35	193	1.4e-83	PFAM
Pfam:Ten_N	187	365	5e-78	PFAM
transmembrane domain	366	388	N/A	INTRINSIC
EGF_like	592	620	3.43e1	SMART
EGF	623	651	2.29e1	SMART
EGF	656	685	1.88e-1	SMART
EGF	688	717	1.13e1	SMART
EGF	722	752	2.39e1	SMART
EGF	755	783	4.32e-1	SMART
EGF	786	814	6.02e0	SMART
EGF	826	858	9.93e-1	SMART
low complexity region	864	878	N/A	INTRINSIC
Pfam:RHS_repeat	2298	2351	3.8e-7	PFAM
Pfam:Tox-GHH	2711	2789	3.9e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140140

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	A	G	17: 9,005,712	K450R	probably damaging	Het
Abcd2	T	C	15: 91,159,182	D601G	probably benign	Het
Abcf3	A	G	16: 20,549,058	K56E	possibly damaging	Het
Acaca	T	C	11: 84,312,854	V1477A	probably damaging	Het
Adamts20	G	A	15: 94,333,647	P887L	possibly damaging	Het
Ahnak	T	G	19: 9,016,735	S5128A	probably benign	Het
Ahsa2	C	A	11: 23,493,162	V197F	probably benign	Het
Ak9	C	A	10: 41,345,460	H402N	probably benign	Het
Alpk1	G	T	3: 127,687,592	N175K	possibly damaging	Het
Als2	A	G	1: 59,215,313	V295A	probably benign	Het
Ankrd16	A	G	2: 11,778,797	D70G	probably damaging	Het
Apob	A	T	12: 8,006,205	K1562N	probably damaging	Het
Arfgap2	C	A	2: 91,269,971	S250R	probably damaging	Het
Arhgef10l	C	T	4: 140,536,883	M671I	possibly damaging	Het
Atrnl1	A	G	19: 57,629,158	I122V	probably damaging	Het
B4galnt2	C	T	11: 95,876,097		probably null	Het
C8a	A	G	4: 104,856,421	Y171H	probably damaging	Het
Cacnb4	A	G	2: 52,474,915	V112A	probably benign	Het
Capn9	G	T	8: 124,613,456	C566F	possibly damaging	Het
Ccdc88a	T	A	11: 29,447,956	S230T	probably benign	Het
Cd300c2	A	T	11: 114,996,985	F197Y	probably benign	Het
Chd5	A	G	4: 152,360,582	Y340C	probably damaging	Het
Chrd	A	T	16: 20,738,808	I726F	possibly damaging	Het
Chrna10	G	A	7: 102,113,219	P255S	possibly damaging	Het
Clasp1	T	A	1: 118,543,197	Y197*	probably null	Het
Cyp2c69	C	G	19: 39,849,408	G410A	probably benign	Het
Cyp2e1	G	A	7: 140,763,908	V20I	possibly damaging	Het
Dapp1	T	C	3: 137,933,167	D225G	probably benign	Het
Dnah5	A	T	15: 28,372,375	D2924V	probably damaging	Het
Efcab12	A	T	6: 115,814,549	L554Q	possibly damaging	Het
Emsy	T	C	7: 98,597,104	T228A	possibly damaging	Het
Evc2	G	A	5: 37,421,860	V1106I	probably benign	Het
Exoc8	G	T	8: 124,897,470	Q53K	possibly damaging	Het
Fam160a1	G	T	3: 85,688,570	T115K	probably damaging	Het
Fbn2	A	T	18: 58,056,272	V1594D	probably damaging	Het
Fer1l4	T	C	2: 156,045,623	Y551C	possibly damaging	Het
Fmnl3	A	G	15: 99,323,481	M481T	probably benign	Het
Fras1	A	G	5: 96,735,238	N2543S	probably damaging	Het
Fsd2	T	C	7: 81,559,680	D138G	probably damaging	Het
Gda	C	T	19: 21,428,628	V5I	probably benign	Het
Glt8d2	A	T	10: 82,660,749	D158E	probably damaging	Het
Gpx6	C	T	13: 21,312,264	Q3*	probably null	Het
Greb1l	A	G	18: 10,532,922	M830V	probably benign	Het
Hnrnpul1	A	C	7: 25,726,833	V531G	probably damaging	Het
Ifi206	A	T	1: 173,480,866	H521Q	probably benign	Het
Igsf3	G	C	3: 101,458,094	R1127P	probably benign	Het
Il1rl1	A	G	1: 40,450,188	R367G	probably damaging	Het
Islr	T	C	9: 58,157,687	D179G	possibly damaging	Het
Jcad	G	T	18: 4,649,338	E70*	probably null	Het
Kcnd2	T	C	6: 21,723,212	I467T	probably benign	Het
Lrrc27	A	G	7: 139,242,698	T502A	probably benign	Het
Lrrtm3	T	A	10: 64,088,002	H462L	probably benign	Het
Mbd5	T	C	2: 49,250,156	L44S	probably damaging	Het
Mccc1	C	A	3: 35,975,873	M429I	probably damaging	Het
Mgam	A	T	6: 40,714,632		probably null	Het
Mipep	T	A	14: 60,872,103	I643N	probably damaging	Het
Mmrn1	A	T	6: 60,988,473	I1162L	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mug1	G	A	6: 121,884,641	C1354Y	probably damaging	Het
Nbeal2	A	T	9: 110,632,055	S1647T	probably benign	Het
Ndufaf2	C	G	13: 108,052,780	A145P	probably damaging	Het
Nedd9	A	T	13: 41,338,575		probably null	Het
Nr4a2	T	A	2: 57,112,093	H116L	probably benign	Het
Nwd2	A	G	5: 63,794,322	Y232C	probably damaging	Het
Odf4	A	G	11: 68,926,688	L58P	probably damaging	Het
Olfr1197	T	A	2: 88,728,712	M296L	possibly damaging	Het
Olfr1221	A	T	2: 89,112,232	F93L	probably damaging	Het
Olfr1284	T	A	2: 111,379,645	L215H	probably damaging	Het
Olfr284	G	T	15: 98,340,778	H70Q	possibly damaging	Het
Olfr434	T	A	6: 43,216,949	V12D	probably benign	Het
Olfr58	C	T	9: 19,783,300	H18Y	probably damaging	Het
Olfr938	A	G	9: 39,078,262	V161A	probably benign	Het
Orc6	T	A	8: 85,302,950	I41K	probably damaging	Het
Pikfyve	A	G	1: 65,267,846	T1798A	probably benign	Het
Prdx6b	T	C	2: 80,293,060	L71P	probably damaging	Het
Prmt2	A	G	10: 76,226,221	I50T	probably damaging	Het
Ptdss1	T	C	13: 66,995,418		probably null	Het
Pygl	T	C	12: 70,207,758	T138A	possibly damaging	Het
Rab3c	T	C	13: 110,061,900	E198G	probably benign	Het
Rbl2	A	G	8: 91,085,568	Y255C	probably damaging	Het
Rev3l	T	A	10: 39,823,397	S1297T	probably damaging	Het
Rgma	C	A	7: 73,417,816	T367K	probably damaging	Het
Rps6ka5	C	T	12: 100,597,885		probably null	Het
Rslcan18	A	T	13: 67,098,526	C217S	probably damaging	Het
Rtp3	A	G	9: 110,986,211		probably benign	Het
Ryr1	A	T	7: 29,045,662	N3848K	probably damaging	Het
Sema6a	T	A	18: 47,248,712	T923S	probably benign	Het
Serpinb6d	A	T	13: 33,671,353	T337S	possibly damaging	Het
Sf3b1	G	A	1: 54,990,507	T1112M	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sidt1	A	T	16: 44,269,858	Y369*	probably null	Het
Slc16a6	A	G	11: 109,463,367	S59P	probably benign	Het
Slc25a17	A	C	15: 81,327,326	L163W	probably damaging	Het
Slc44a3	T	C	3: 121,527,074	T93A	possibly damaging	Het
Sptbn1	T	C	11: 30,137,197	T1081A	possibly damaging	Het
Sptbn4	T	C	7: 27,417,006	D456G	probably benign	Het
Sycp1	C	A	3: 102,853,489	A703S	possibly damaging	Het
Tas2r118	T	A	6: 23,969,226	M279L	probably benign	Het
Tc2n	T	G	12: 101,694,573	Q133H	probably benign	Het
Tctn1	A	G	5: 122,261,405		probably null	Het
Tex10	A	T	4: 48,468,984	S64T	probably benign	Het
Tex15	A	G	8: 33,582,497	T2691A	probably benign	Het
Tmem175	A	T	5: 108,642,150	T123S	probably damaging	Het
Tsc1	C	A	2: 28,672,407	S348R	probably damaging	Het
Ttll4	A	T	1: 74,679,007	T6S	possibly damaging	Het
Ttll8	A	T	15: 88,917,090	I465N	probably damaging	Het
Ubr3	A	G	2: 69,938,370		probably benign	Het
Ugdh	A	T	5: 65,423,352		probably null	Het
Usp34	T	C	11: 23,487,215	L3326S	probably damaging	Het
Vmn2r125	A	T	4: 156,349,981	I21F	probably damaging	Het
Vps9d1	G	A	8: 123,248,612		probably benign	Het
Xab2	G	A	8: 3,618,117	R154C	possibly damaging	Het
Zbtb12	T	C	17: 34,895,499	S87P	probably damaging	Het
Zc3h12a	A	G	4: 125,120,893	M266T	probably damaging	Het
Zfp108	G	A	7: 24,260,412	A143T	probably benign	Het

Other mutations in Tenm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Tenm4	APN	7	96868009	missense	probably benign	0.00
IGL00468:Tenm4	APN	7	96874472	missense	probably damaging	0.98
IGL00519:Tenm4	APN	7	96805138	splice site	probably benign
IGL00979:Tenm4	APN	7	96729391	missense	probably damaging	0.96
IGL01401:Tenm4	APN	7	96874267	missense	probably damaging	1.00
IGL01459:Tenm4	APN	7	96729385	missense	probably damaging	1.00
IGL01519:Tenm4	APN	7	96895177	missense	probably damaging	1.00
IGL01545:Tenm4	APN	7	96874303	missense	probably benign	0.00
IGL01579:Tenm4	APN	7	96863502	missense	probably benign	0.00
IGL01587:Tenm4	APN	7	96863502	missense	probably benign	0.00
IGL01625:Tenm4	APN	7	96885358	missense	probably damaging	1.00
IGL01655:Tenm4	APN	7	96553724	missense	probably damaging	1.00
IGL01683:Tenm4	APN	7	96885404	missense	possibly damaging	0.84
IGL01728:Tenm4	APN	7	96896064	missense	probably damaging	1.00
IGL01732:Tenm4	APN	7	96895509	missense	probably damaging	1.00
IGL01924:Tenm4	APN	7	96895212	missense	probably damaging	1.00
IGL01966:Tenm4	APN	7	96553550	missense	probably damaging	1.00
IGL02177:Tenm4	APN	7	96895662	missense	probably benign	0.40
IGL02207:Tenm4	APN	7	96874116	missense	possibly damaging	0.85
IGL02269:Tenm4	APN	7	96823822	missense	probably damaging	1.00
IGL02274:Tenm4	APN	7	96854734	missense	probably damaging	1.00
IGL02375:Tenm4	APN	7	96704137	missense	possibly damaging	0.52
IGL02415:Tenm4	APN	7	96874074	missense	probably damaging	0.98
IGL02472:Tenm4	APN	7	96774176	unclassified	probably benign
IGL02656:Tenm4	APN	7	96885433	missense	probably damaging	1.00
IGL02678:Tenm4	APN	7	96896219	missense	probably damaging	1.00
IGL02829:Tenm4	APN	7	96894998	nonsense	probably null
IGL02863:Tenm4	APN	7	96873706	missense	probably damaging	1.00
IGL03145:Tenm4	APN	7	96842968	missense	probably damaging	0.98
IGL03153:Tenm4	APN	7	96873762	missense	probably damaging	1.00
principium	UTSW	7	96797481	missense	probably damaging	0.98
toccata	UTSW	7	96902989	critical splice donor site	probably null
P0026:Tenm4	UTSW	7	96874527	missense	probably damaging	1.00
R0097:Tenm4	UTSW	7	96892926	missense	probably damaging	1.00
R0097:Tenm4	UTSW	7	96892926	missense	probably damaging	1.00
R0140:Tenm4	UTSW	7	96896052	missense	possibly damaging	0.78
R0164:Tenm4	UTSW	7	96729340	splice site	probably benign
R0277:Tenm4	UTSW	7	96694950	missense	possibly damaging	0.54
R0323:Tenm4	UTSW	7	96694950	missense	possibly damaging	0.54
R0362:Tenm4	UTSW	7	96772035	nonsense	probably null
R0381:Tenm4	UTSW	7	96905881	missense	probably damaging	1.00
R0420:Tenm4	UTSW	7	96873766	missense	possibly damaging	0.85
R0426:Tenm4	UTSW	7	96777851	missense	probably damaging	1.00
R0513:Tenm4	UTSW	7	96895623	missense	probably benign	0.35
R0624:Tenm4	UTSW	7	96774020	missense	probably damaging	1.00
R0837:Tenm4	UTSW	7	96896275	splice site	probably benign
R1037:Tenm4	UTSW	7	96797481	missense	probably damaging	0.98
R1172:Tenm4	UTSW	7	96848044	missense	probably damaging	1.00
R1422:Tenm4	UTSW	7	96550051	missense	probably damaging	0.99
R1427:Tenm4	UTSW	7	96843048	missense	probably benign	0.42
R1462:Tenm4	UTSW	7	96704153	missense	probably damaging	1.00
R1462:Tenm4	UTSW	7	96704153	missense	probably damaging	1.00
R1597:Tenm4	UTSW	7	96902989	critical splice donor site	probably null
R1701:Tenm4	UTSW	7	96902889	missense	probably damaging	1.00
R1707:Tenm4	UTSW	7	96888685	missense	probably damaging	1.00
R1809:Tenm4	UTSW	7	96873780	missense	probably benign	0.17
R1812:Tenm4	UTSW	7	96895940	missense	probably damaging	1.00
R1895:Tenm4	UTSW	7	96735808	missense	probably damaging	1.00
R1933:Tenm4	UTSW	7	96895326	missense	probably damaging	1.00
R1946:Tenm4	UTSW	7	96735808	missense	probably damaging	1.00
R2108:Tenm4	UTSW	7	96906290	missense	probably damaging	1.00
R2151:Tenm4	UTSW	7	96902847	missense	probably damaging	1.00
R2247:Tenm4	UTSW	7	96906009	missense	probably benign	0.03
R2329:Tenm4	UTSW	7	96895862	missense	probably benign	0.00
R2893:Tenm4	UTSW	7	96894990	missense	probably damaging	1.00
R2990:Tenm4	UTSW	7	96893125	splice site	probably null
R3409:Tenm4	UTSW	7	96895160	missense	probably damaging	1.00
R3410:Tenm4	UTSW	7	96852530	missense	probably damaging	0.99
R3411:Tenm4	UTSW	7	96852530	missense	probably damaging	0.99
R3440:Tenm4	UTSW	7	96553516	missense	probably benign	0.00
R3441:Tenm4	UTSW	7	96553516	missense	probably benign	0.00
R3719:Tenm4	UTSW	7	96863563	missense	possibly damaging	0.92
R3772:Tenm4	UTSW	7	96694880	missense	probably damaging	1.00
R3773:Tenm4	UTSW	7	96694880	missense	probably damaging	1.00
R4093:Tenm4	UTSW	7	96895772	missense	probably damaging	1.00
R4439:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4441:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4510:Tenm4	UTSW	7	96894863	missense	probably benign
R4511:Tenm4	UTSW	7	96894863	missense	probably benign
R4543:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4645:Tenm4	UTSW	7	96895742	missense	probably damaging	1.00
R4701:Tenm4	UTSW	7	96895349	missense	probably damaging	1.00
R4714:Tenm4	UTSW	7	96894924	missense	probably damaging	1.00
R4742:Tenm4	UTSW	7	96797484	missense	probably damaging	0.99
R4784:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4785:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4801:Tenm4	UTSW	7	96906245	missense	probably damaging	0.97
R4802:Tenm4	UTSW	7	96906245	missense	probably damaging	0.97
R4880:Tenm4	UTSW	7	96905818	splice site	probably null
R5036:Tenm4	UTSW	7	96694790	missense	probably damaging	1.00
R5036:Tenm4	UTSW	7	96852561	missense	probably damaging	1.00
R5050:Tenm4	UTSW	7	96895788	missense	probably damaging	1.00
R5103:Tenm4	UTSW	7	96842957	missense	probably damaging	1.00
R5106:Tenm4	UTSW	7	96843149	missense	probably damaging	0.99
R5118:Tenm4	UTSW	7	96893086	missense	probably damaging	1.00
R5272:Tenm4	UTSW	7	96874203	missense	probably damaging	0.98
R5282:Tenm4	UTSW	7	96837331	missense	possibly damaging	0.90
R5403:Tenm4	UTSW	7	96888827	missense	probably damaging	1.00
R5404:Tenm4	UTSW	7	96894680	missense	probably damaging	1.00
R5567:Tenm4	UTSW	7	96896209	nonsense	probably null
R5590:Tenm4	UTSW	7	96797400	missense	possibly damaging	0.73
R5590:Tenm4	UTSW	7	96797401	missense	possibly damaging	0.93
R5597:Tenm4	UTSW	7	96553517	missense	probably benign	0.00
R5782:Tenm4	UTSW	7	96893039	missense	probably benign	0.00
R5861:Tenm4	UTSW	7	96843217	intron	probably benign
R5890:Tenm4	UTSW	7	96902860	missense	probably damaging	1.00
R5930:Tenm4	UTSW	7	96854719	missense	probably damaging	1.00
R5940:Tenm4	UTSW	7	96845895	missense	probably damaging	1.00
R6012:Tenm4	UTSW	7	96522433	intron	probably benign
R6060:Tenm4	UTSW	7	96873711	missense	probably damaging	1.00
R6104:Tenm4	UTSW	7	96837289	missense	probably damaging	0.97
R6283:Tenm4	UTSW	7	96874494	missense	probably benign	0.33
R6333:Tenm4	UTSW	7	96774124	missense	probably damaging	1.00
R6522:Tenm4	UTSW	7	96843044	missense	possibly damaging	0.88
R6616:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6746:Tenm4	UTSW	7	96892860	missense	probably damaging	1.00
R6751:Tenm4	UTSW	7	96845712	missense	possibly damaging	0.95
R6806:Tenm4	UTSW	7	96811959	missense	possibly damaging	0.95
R6807:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6807:Tenm4	UTSW	7	96895271	missense	probably damaging	1.00
R6809:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6810:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6811:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6853:Tenm4	UTSW	7	96837295	missense	possibly damaging	0.94
R6886:Tenm4	UTSW	7	96797392	missense	possibly damaging	0.85
R6920:Tenm4	UTSW	7	96895550	missense	probably damaging	1.00
R6937:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6939:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7011:Tenm4	UTSW	7	96896135	nonsense	probably null
R7033:Tenm4	UTSW	7	96895223	nonsense	probably null
R7040:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7083:Tenm4	UTSW	7	96895349	missense	probably damaging	1.00
R7238:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7239:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7239:Tenm4	UTSW	7	96735813	missense	possibly damaging	0.47
R7337:Tenm4	UTSW	7	96874126	missense	probably benign	0.44
R7400:Tenm4	UTSW	7	96694803	missense	probably damaging	0.97
R7407:Tenm4	UTSW	7	96773987	missense	possibly damaging	0.89
R7449:Tenm4	UTSW	7	96874213	missense	possibly damaging	0.65
R7473:Tenm4	UTSW	7	96774146	missense	probably damaging	1.00
R7477:Tenm4	UTSW	7	96845808	missense	probably damaging	0.99
R7489:Tenm4	UTSW	7	96837314	missense	possibly damaging	0.90
R7498:Tenm4	UTSW	7	96848017	missense	probably damaging	1.00
R7562:Tenm4	UTSW	7	96888814	missense	probably damaging	1.00
R7615:Tenm4	UTSW	7	96845926	missense	probably damaging	1.00
R7624:Tenm4	UTSW	7	96895985	missense	possibly damaging	0.95
R7626:Tenm4	UTSW	7	96893014	missense	probably damaging	1.00
R7690:Tenm4	UTSW	7	96863533	missense	probably benign	0.00
R7692:Tenm4	UTSW	7	96895403	missense	probably damaging	1.00
R7748:Tenm4	UTSW	7	96894702	missense	probably damaging	1.00
R7763:Tenm4	UTSW	7	96895692	missense	probably benign	0.38
R7792:Tenm4	UTSW	7	96774014	missense	possibly damaging	0.54
R7855:Tenm4	UTSW	7	96873874	missense	probably damaging	1.00
R7868:Tenm4	UTSW	7	96906380	missense	possibly damaging	0.79
R7878:Tenm4	UTSW	7	96852357	missense	probably damaging	1.00
R7997:Tenm4	UTSW	7	96874305	missense	probably benign	0.44
R8017:Tenm4	UTSW	7	96704041	missense	probably damaging	1.00
R8019:Tenm4	UTSW	7	96704041	missense	probably damaging	1.00
R8054:Tenm4	UTSW	7	96729346	splice site	probably benign
R8061:Tenm4	UTSW	7	96852456	missense	probably damaging	1.00
R8108:Tenm4	UTSW	7	96854728	missense	probably benign	0.39
R8140:Tenm4	UTSW	7	96895176	missense	probably damaging	1.00
R8214:Tenm4	UTSW	7	96895407	missense	probably damaging	1.00
R8258:Tenm4	UTSW	7	96867991	missense	probably damaging	1.00
R8259:Tenm4	UTSW	7	96867991	missense	probably damaging	1.00
R8364:Tenm4	UTSW	7	96772106	critical splice donor site	probably null
R8542:Tenm4	UTSW	7	96811932	missense	probably damaging	0.99
R8669:Tenm4	UTSW	7	96905941	missense	probably benign
R8670:Tenm4	UTSW	7	96905941	missense	probably benign
R8683:Tenm4	UTSW	7	96902857	missense	probably damaging	0.99
R8691:Tenm4	UTSW	7	96905941	missense	probably benign
R8692:Tenm4	UTSW	7	96905941	missense	probably benign
R8714:Tenm4	UTSW	7	96905941	missense	probably benign
R8716:Tenm4	UTSW	7	96905941	missense	probably benign
R8735:Tenm4	UTSW	7	96905941	missense	probably benign
R8736:Tenm4	UTSW	7	96905941	missense	probably benign
R8737:Tenm4	UTSW	7	96905941	missense	probably benign
R8738:Tenm4	UTSW	7	96873840	missense	probably damaging	1.00
R8738:Tenm4	UTSW	7	96905941	missense	probably benign
R8739:Tenm4	UTSW	7	96905941	missense	probably benign
R8776:Tenm4	UTSW	7	96895032	missense	probably damaging	1.00
R8776-TAIL:Tenm4	UTSW	7	96895032	missense	probably damaging	1.00
R8777:Tenm4	UTSW	7	96896037	missense	probably damaging	1.00
R8777-TAIL:Tenm4	UTSW	7	96896037	missense	probably damaging	1.00
R8817:Tenm4	UTSW	7	96874128	missense	probably benign	0.01
R8851:Tenm4	UTSW	7	96852503	missense	probably damaging	1.00
R8913:Tenm4	UTSW	7	96702745	splice site	probably benign
R8977:Tenm4	UTSW	7	96811970	missense	probably damaging	1.00
R9100:Tenm4	UTSW	7	96845854	missense	probably damaging	1.00
R9136:Tenm4	UTSW	7	96823918	missense	possibly damaging	0.69
R9163:Tenm4	UTSW	7	96823873	missense	probably damaging	1.00
R9188:Tenm4	UTSW	7	96772027	missense	probably damaging	1.00
R9195:Tenm4	UTSW	7	96892919	missense	probably damaging	1.00
R9217:Tenm4	UTSW	7	96885439	missense	probably damaging	1.00
R9344:Tenm4	UTSW	7	96896145	missense	probably damaging	1.00
R9414:Tenm4	UTSW	7	96896160	missense	probably benign
R9466:Tenm4	UTSW	7	96550045	missense	possibly damaging	0.79
R9559:Tenm4	UTSW	7	96823849	missense	probably benign
R9626:Tenm4	UTSW	7	96896138	missense	probably damaging	1.00
R9673:Tenm4	UTSW	7	96867989	missense	probably damaging	1.00
R9676:Tenm4	UTSW	7	96895431	missense	probably damaging	1.00
R9678:Tenm4	UTSW	7	96737412	missense	possibly damaging	0.94
R9775:Tenm4	UTSW	7	96906554	missense	possibly damaging	0.92
R9790:Tenm4	UTSW	7	96888839	missense	probably damaging	1.00
R9791:Tenm4	UTSW	7	96888839	missense	probably damaging	1.00
R9803:Tenm4	UTSW	7	96553478	missense	probably damaging	1.00
X0021:Tenm4	UTSW	7	96873909	nonsense	probably null
X0026:Tenm4	UTSW	7	96868087	missense	probably damaging	0.98
X0066:Tenm4	UTSW	7	96848030	missense	probably damaging	1.00
X0066:Tenm4	UTSW	7	96894794	missense	probably damaging	1.00
Z1176:Tenm4	UTSW	7	96905914	missense	probably benign	0.00
Z1177:Tenm4	UTSW	7	96863585	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CTGCAATGAACCATCGCAG -3'
(R):5'- ATTCCACAGAGCAGGTTGGC -3'

Sequencing Primer
(F):5'- GTTCACTACCAATCAACCGGTGTG -3'
(R):5'- CAGGTTGGCCTCTACCTTAGAG -3'

Posted On

2015-10-21