Mutagenetix > Incidental Mutations

Incidental Mutation 'R4707:Sptbn1'

355350

Institutional Source

Beutler Lab

Gene Symbol

Sptbn1

Ensembl Gene

ENSMUSG00000020315

Gene Name

spectrin beta, non-erythrocytic 1

Synonyms

non-erythrocytic, Spnb-2, elf3, 9930031C03Rik, elf1, beta fodrin, brain spectrin, spectrin G, Spnb2

MMRRC Submission

041955-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4707 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30099395-30268175 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30137197 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1081 (T1081A)

Ref Sequence

ENSEMBL: ENSMUSP00000011877 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006629
AA Change: T1081A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: T1081A

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000011877
AA Change: T1081A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: T1081A

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102838
AA Change: T1068A

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: T1068A

Domain	Start	End	E-Value	Type
CH	43	143	3.02e-28	SMART
CH	162	260	8.73e-25	SMART
SPEC	292	398	2.03e0	SMART
SPEC	412	512	6.42e-26	SMART
SPEC	518	622	4.61e-27	SMART
SPEC	628	728	2.36e-33	SMART
SPEC	734	833	1.2e-25	SMART
SPEC	839	939	7.16e-24	SMART
SPEC	945	1046	6.58e-23	SMART
SPEC	1052	1153	1.79e-24	SMART
SPEC	1159	1259	2.2e-24	SMART
SPEC	1265	1364	5.18e-21	SMART
SPEC	1370	1469	1.02e-19	SMART
SPEC	1475	1576	7.2e-29	SMART
SPEC	1582	1682	8.03e-27	SMART
SPEC	1688	1789	9.73e-26	SMART
SPEC	1795	1895	9.82e-22	SMART
SPEC	1901	2001	8.68e-23	SMART
SPEC	2007	2114	2.66e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124231
AA Change: T1081A

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: T1081A

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2092	6.42e-2	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	A	G	17: 9,005,712	K450R	probably damaging	Het
Abcd2	T	C	15: 91,159,182	D601G	probably benign	Het
Abcf3	A	G	16: 20,549,058	K56E	possibly damaging	Het
Acaca	T	C	11: 84,312,854	V1477A	probably damaging	Het
Adamts20	G	A	15: 94,333,647	P887L	possibly damaging	Het
Ahnak	T	G	19: 9,016,735	S5128A	probably benign	Het
Ahsa2	C	A	11: 23,493,162	V197F	probably benign	Het
Ak9	C	A	10: 41,345,460	H402N	probably benign	Het
Alpk1	G	T	3: 127,687,592	N175K	possibly damaging	Het
Als2	A	G	1: 59,215,313	V295A	probably benign	Het
Ankrd16	A	G	2: 11,778,797	D70G	probably damaging	Het
Apob	A	T	12: 8,006,205	K1562N	probably damaging	Het
Arfgap2	C	A	2: 91,269,971	S250R	probably damaging	Het
Arhgef10l	C	T	4: 140,536,883	M671I	possibly damaging	Het
Atrnl1	A	G	19: 57,629,158	I122V	probably damaging	Het
B4galnt2	C	T	11: 95,876,097		probably null	Het
C8a	A	G	4: 104,856,421	Y171H	probably damaging	Het
Cacnb4	A	G	2: 52,474,915	V112A	probably benign	Het
Capn9	G	T	8: 124,613,456	C566F	possibly damaging	Het
Ccdc88a	T	A	11: 29,447,956	S230T	probably benign	Het
Cd300c2	A	T	11: 114,996,985	F197Y	probably benign	Het
Chd5	A	G	4: 152,360,582	Y340C	probably damaging	Het
Chrd	A	T	16: 20,738,808	I726F	possibly damaging	Het
Chrna10	G	A	7: 102,113,219	P255S	possibly damaging	Het
Clasp1	T	A	1: 118,543,197	Y197*	probably null	Het
Cyp2c69	C	G	19: 39,849,408	G410A	probably benign	Het
Cyp2e1	G	A	7: 140,763,908	V20I	possibly damaging	Het
Dapp1	T	C	3: 137,933,167	D225G	probably benign	Het
Dnah5	A	T	15: 28,372,375	D2924V	probably damaging	Het
Efcab12	A	T	6: 115,814,549	L554Q	possibly damaging	Het
Emsy	T	C	7: 98,597,104	T228A	possibly damaging	Het
Evc2	G	A	5: 37,421,860	V1106I	probably benign	Het
Exoc8	G	T	8: 124,897,470	Q53K	possibly damaging	Het
Fam160a1	G	T	3: 85,688,570	T115K	probably damaging	Het
Fbn2	A	T	18: 58,056,272	V1594D	probably damaging	Het
Fer1l4	T	C	2: 156,045,623	Y551C	possibly damaging	Het
Fmnl3	A	G	15: 99,323,481	M481T	probably benign	Het
Fras1	A	G	5: 96,735,238	N2543S	probably damaging	Het
Fsd2	T	C	7: 81,559,680	D138G	probably damaging	Het
Gda	C	T	19: 21,428,628	V5I	probably benign	Het
Glt8d2	A	T	10: 82,660,749	D158E	probably damaging	Het
Gpx6	C	T	13: 21,312,264	Q3*	probably null	Het
Greb1l	A	G	18: 10,532,922	M830V	probably benign	Het
Hnrnpul1	A	C	7: 25,726,833	V531G	probably damaging	Het
Ifi206	A	T	1: 173,480,866	H521Q	probably benign	Het
Igsf3	G	C	3: 101,458,094	R1127P	probably benign	Het
Il1rl1	A	G	1: 40,450,188	R367G	probably damaging	Het
Islr	T	C	9: 58,157,687	D179G	possibly damaging	Het
Jcad	G	T	18: 4,649,338	E70*	probably null	Het
Kcnd2	T	C	6: 21,723,212	I467T	probably benign	Het
Lrrc27	A	G	7: 139,242,698	T502A	probably benign	Het
Lrrtm3	T	A	10: 64,088,002	H462L	probably benign	Het
Mbd5	T	C	2: 49,250,156	L44S	probably damaging	Het
Mccc1	C	A	3: 35,975,873	M429I	probably damaging	Het
Mgam	A	T	6: 40,714,632		probably null	Het
Mipep	T	A	14: 60,872,103	I643N	probably damaging	Het
Mmrn1	A	T	6: 60,988,473	I1162L	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mug1	G	A	6: 121,884,641	C1354Y	probably damaging	Het
Nbeal2	A	T	9: 110,632,055	S1647T	probably benign	Het
Ndufaf2	C	G	13: 108,052,780	A145P	probably damaging	Het
Nedd9	A	T	13: 41,338,575		probably null	Het
Nr4a2	T	A	2: 57,112,093	H116L	probably benign	Het
Nwd2	A	G	5: 63,794,322	Y232C	probably damaging	Het
Odf4	A	G	11: 68,926,688	L58P	probably damaging	Het
Olfr1197	T	A	2: 88,728,712	M296L	possibly damaging	Het
Olfr1221	A	T	2: 89,112,232	F93L	probably damaging	Het
Olfr1284	T	A	2: 111,379,645	L215H	probably damaging	Het
Olfr284	G	T	15: 98,340,778	H70Q	possibly damaging	Het
Olfr434	T	A	6: 43,216,949	V12D	probably benign	Het
Olfr58	C	T	9: 19,783,300	H18Y	probably damaging	Het
Olfr938	A	G	9: 39,078,262	V161A	probably benign	Het
Orc6	T	A	8: 85,302,950	I41K	probably damaging	Het
Pikfyve	A	G	1: 65,267,846	T1798A	probably benign	Het
Prdx6b	T	C	2: 80,293,060	L71P	probably damaging	Het
Prmt2	A	G	10: 76,226,221	I50T	probably damaging	Het
Ptdss1	T	C	13: 66,995,418		probably null	Het
Pygl	T	C	12: 70,207,758	T138A	possibly damaging	Het
Rab3c	T	C	13: 110,061,900	E198G	probably benign	Het
Rbl2	A	G	8: 91,085,568	Y255C	probably damaging	Het
Rev3l	T	A	10: 39,823,397	S1297T	probably damaging	Het
Rgma	C	A	7: 73,417,816	T367K	probably damaging	Het
Rps6ka5	C	T	12: 100,597,885		probably null	Het
Rslcan18	A	T	13: 67,098,526	C217S	probably damaging	Het
Rtp3	A	G	9: 110,986,211		probably benign	Het
Ryr1	A	T	7: 29,045,662	N3848K	probably damaging	Het
Sema6a	T	A	18: 47,248,712	T923S	probably benign	Het
Serpinb6d	A	T	13: 33,671,353	T337S	possibly damaging	Het
Sf3b1	G	A	1: 54,990,507	T1112M	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sidt1	A	T	16: 44,269,858	Y369*	probably null	Het
Slc16a6	A	G	11: 109,463,367	S59P	probably benign	Het
Slc25a17	A	C	15: 81,327,326	L163W	probably damaging	Het
Slc44a3	T	C	3: 121,527,074	T93A	possibly damaging	Het
Sptbn4	T	C	7: 27,417,006	D456G	probably benign	Het
Sycp1	C	A	3: 102,853,489	A703S	possibly damaging	Het
Tas2r118	T	A	6: 23,969,226	M279L	probably benign	Het
Tc2n	T	G	12: 101,694,573	Q133H	probably benign	Het
Tctn1	A	G	5: 122,261,405		probably null	Het
Tenm4	A	C	7: 96,774,046	K683Q	probably damaging	Het
Tex10	A	T	4: 48,468,984	S64T	probably benign	Het
Tex15	A	G	8: 33,582,497	T2691A	probably benign	Het
Tmem175	A	T	5: 108,642,150	T123S	probably damaging	Het
Tsc1	C	A	2: 28,672,407	S348R	probably damaging	Het
Ttll4	A	T	1: 74,679,007	T6S	possibly damaging	Het
Ttll8	A	T	15: 88,917,090	I465N	probably damaging	Het
Ubr3	A	G	2: 69,938,370		probably benign	Het
Ugdh	A	T	5: 65,423,352		probably null	Het
Usp34	T	C	11: 23,487,215	L3326S	probably damaging	Het
Vmn2r125	A	T	4: 156,349,981	I21F	probably damaging	Het
Vps9d1	G	A	8: 123,248,612		probably benign	Het
Xab2	G	A	8: 3,618,117	R154C	possibly damaging	Het
Zbtb12	T	C	17: 34,895,499	S87P	probably damaging	Het
Zc3h12a	A	G	4: 125,120,893	M266T	probably damaging	Het
Zfp108	G	A	7: 24,260,412	A143T	probably benign	Het

Other mutations in Sptbn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Sptbn1	APN	11	30110818	nonsense	probably null
IGL01098:Sptbn1	APN	11	30159385	missense	probably damaging	1.00
IGL01843:Sptbn1	APN	11	30104623	missense	probably benign	0.02
IGL02070:Sptbn1	APN	11	30145979	missense	probably damaging	0.99
IGL02075:Sptbn1	APN	11	30138496	missense	probably damaging	1.00
IGL02094:Sptbn1	APN	11	30100659	missense	probably benign	0.01
IGL02102:Sptbn1	APN	11	30137427	missense	probably damaging	1.00
IGL02189:Sptbn1	APN	11	30117871	missense	probably damaging	1.00
IGL02256:Sptbn1	APN	11	30120990	missense	probably benign	0.24
IGL02301:Sptbn1	APN	11	30142129	missense	probably damaging	1.00
IGL02354:Sptbn1	APN	11	30110783	missense	probably damaging	1.00
IGL02361:Sptbn1	APN	11	30110783	missense	probably damaging	1.00
IGL02377:Sptbn1	APN	11	30119491	missense	possibly damaging	0.92
IGL02504:Sptbn1	APN	11	30142293	missense	probably damaging	1.00
IGL02672:Sptbn1	APN	11	30137239	missense	probably damaging	1.00
IGL02733:Sptbn1	APN	11	30197747	missense	probably benign	0.12
IGL02755:Sptbn1	APN	11	30142247	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30123855	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30123855	missense	probably damaging	1.00
R0096:Sptbn1	UTSW	11	30114739	missense	probably damaging	1.00
R0139:Sptbn1	UTSW	11	30142289	missense	probably benign	0.00
R0370:Sptbn1	UTSW	11	30121545	missense	probably benign
R0389:Sptbn1	UTSW	11	30139250	missense	possibly damaging	0.95
R0415:Sptbn1	UTSW	11	30149576	missense	probably damaging	1.00
R0552:Sptbn1	UTSW	11	30145985	missense	possibly damaging	0.92
R0601:Sptbn1	UTSW	11	30150008	missense	probably damaging	1.00
R0609:Sptbn1	UTSW	11	30138979	missense	probably damaging	1.00
R0675:Sptbn1	UTSW	11	30117903	missense	probably damaging	1.00
R0708:Sptbn1	UTSW	11	30114739	missense	probably damaging	1.00
R0711:Sptbn1	UTSW	11	30114739	missense	probably damaging	1.00
R0729:Sptbn1	UTSW	11	30110902	missense	probably damaging	0.96
R0755:Sptbn1	UTSW	11	30139016	missense	probably damaging	1.00
R0892:Sptbn1	UTSW	11	30142201	missense	probably damaging	1.00
R0927:Sptbn1	UTSW	11	30121591	missense	probably damaging	1.00
R1102:Sptbn1	UTSW	11	30120785	missense	possibly damaging	0.93
R1460:Sptbn1	UTSW	11	30138637	missense	possibly damaging	0.50
R1479:Sptbn1	UTSW	11	30113909	missense	probably damaging	1.00
R1496:Sptbn1	UTSW	11	30121498	missense	probably damaging	1.00
R1649:Sptbn1	UTSW	11	30137301	missense	probably damaging	0.97
R1663:Sptbn1	UTSW	11	30120783	missense	possibly damaging	0.53
R1671:Sptbn1	UTSW	11	30142245	missense	possibly damaging	0.57
R1680:Sptbn1	UTSW	11	30159371	missense	possibly damaging	0.92
R1695:Sptbn1	UTSW	11	30136124	missense	probably benign	0.13
R1868:Sptbn1	UTSW	11	30114781	missense	possibly damaging	0.70
R1918:Sptbn1	UTSW	11	30142414	missense	probably damaging	1.00
R1921:Sptbn1	UTSW	11	30104469	missense	probably damaging	0.98
R2026:Sptbn1	UTSW	11	30104559	missense	probably benign	0.02
R2038:Sptbn1	UTSW	11	30159293	critical splice donor site	probably null
R2047:Sptbn1	UTSW	11	30138360	splice site	probably benign
R2312:Sptbn1	UTSW	11	30154249	missense	probably damaging	1.00
R3430:Sptbn1	UTSW	11	30219686	missense	possibly damaging	0.67
R3624:Sptbn1	UTSW	11	30140593	missense	probably damaging	1.00
R3723:Sptbn1	UTSW	11	30137335	missense	possibly damaging	0.59
R3862:Sptbn1	UTSW	11	30142329	missense	possibly damaging	0.63
R4446:Sptbn1	UTSW	11	30139114	missense	possibly damaging	0.70
R4582:Sptbn1	UTSW	11	30219597	missense	probably damaging	1.00
R4705:Sptbn1	UTSW	11	30100660	missense	probably benign
R4718:Sptbn1	UTSW	11	30154297	missense	probably damaging	1.00
R4789:Sptbn1	UTSW	11	30117759	missense	probably benign
R4824:Sptbn1	UTSW	11	30118295	missense	possibly damaging	0.72
R4855:Sptbn1	UTSW	11	30142353	missense	probably damaging	1.00
R5009:Sptbn1	UTSW	11	30124016	missense	probably benign	0.05
R5071:Sptbn1	UTSW	11	30113854	critical splice donor site	probably null
R5153:Sptbn1	UTSW	11	30121510	missense	possibly damaging	0.82
R5334:Sptbn1	UTSW	11	30137364	missense	possibly damaging	0.92
R5462:Sptbn1	UTSW	11	30100520	missense	possibly damaging	0.94
R5523:Sptbn1	UTSW	11	30137560	missense	probably damaging	1.00
R5707:Sptbn1	UTSW	11	30143174	missense	possibly damaging	0.65
R5724:Sptbn1	UTSW	11	30144113	missense	possibly damaging	0.91
R5738:Sptbn1	UTSW	11	30145941	missense	probably damaging	1.00
R5864:Sptbn1	UTSW	11	30145925	missense	probably damaging	1.00
R5895:Sptbn1	UTSW	11	30123978	missense	probably damaging	0.99
R5932:Sptbn1	UTSW	11	30136136	missense	probably damaging	1.00
R5966:Sptbn1	UTSW	11	30124873	missense	probably damaging	1.00
R5984:Sptbn1	UTSW	11	30118464	missense	probably damaging	1.00
R6155:Sptbn1	UTSW	11	30137403	missense	probably damaging	0.99
R6163:Sptbn1	UTSW	11	30159443	nonsense	probably null
R6226:Sptbn1	UTSW	11	30136054	missense	probably damaging	1.00
R6271:Sptbn1	UTSW	11	30100660	missense	probably benign	0.00
R6443:Sptbn1	UTSW	11	30139429	missense	possibly damaging	0.56
R6591:Sptbn1	UTSW	11	30113984	missense	probably damaging	0.99
R6616:Sptbn1	UTSW	11	30124030	missense	probably benign	0.08
R6691:Sptbn1	UTSW	11	30113984	missense	probably damaging	0.99
R6751:Sptbn1	UTSW	11	30117859	missense	probably damaging	1.00
R6823:Sptbn1	UTSW	11	30114787	missense	probably damaging	1.00
R6863:Sptbn1	UTSW	11	30146777	missense	possibly damaging	0.94
R6885:Sptbn1	UTSW	11	30138634	missense	probably benign	0.26
R6892:Sptbn1	UTSW	11	30142187	missense	probably benign	0.27
R6998:Sptbn1	UTSW	11	30100633	missense	probably damaging	0.97
R7043:Sptbn1	UTSW	11	30103323	missense	probably benign	0.02
R7092:Sptbn1	UTSW	11	30137119	missense	possibly damaging	0.75
R7272:Sptbn1	UTSW	11	30114859	missense	possibly damaging	0.93
R7301:Sptbn1	UTSW	11	30117798	nonsense	probably null
R7379:Sptbn1	UTSW	11	30139292	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- CATTCCAGCCAGTGTCTAAGGC -3'
(R):5'- AAGCTGAGAAGCTGGAGTCC -3'

Sequencing Primer
(F):5'- CTGCCGCAGAAACATATACTGGG -3'
(R):5'- AAGCTGGAGTCCGAGCAC -3'

Posted On

2015-10-21