Incidental Mutation 'R4707:Acaca'
ID 355355
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Name acetyl-Coenzyme A carboxylase alpha
Synonyms LOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
MMRRC Submission 041955-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4707 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 84129672-84401651 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84312854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1477 (V1477A)
Ref Sequence ENSEMBL: ENSMUSP00000099490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201] [ENSMUST00000183887]
AlphaFold Q5SWU9
Predicted Effect probably damaging
Transcript: ENSMUST00000020843
AA Change: V1477A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: V1477A

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103201
AA Change: V1477A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: V1477A

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183887
SMART Domains Protein: ENSMUSP00000139378
Gene: ENSMUSG00000020532

DomainStartEndE-ValueType
Pfam:ACC_central 1 228 8.6e-57 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,005,712 K450R probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Abcf3 A G 16: 20,549,058 K56E possibly damaging Het
Adamts20 G A 15: 94,333,647 P887L possibly damaging Het
Ahnak T G 19: 9,016,735 S5128A probably benign Het
Ahsa2 C A 11: 23,493,162 V197F probably benign Het
Ak9 C A 10: 41,345,460 H402N probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Ankrd16 A G 2: 11,778,797 D70G probably damaging Het
Apob A T 12: 8,006,205 K1562N probably damaging Het
Arfgap2 C A 2: 91,269,971 S250R probably damaging Het
Arhgef10l C T 4: 140,536,883 M671I possibly damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
B4galnt2 C T 11: 95,876,097 probably null Het
C8a A G 4: 104,856,421 Y171H probably damaging Het
Cacnb4 A G 2: 52,474,915 V112A probably benign Het
Capn9 G T 8: 124,613,456 C566F possibly damaging Het
Ccdc88a T A 11: 29,447,956 S230T probably benign Het
Cd300c2 A T 11: 114,996,985 F197Y probably benign Het
Chd5 A G 4: 152,360,582 Y340C probably damaging Het
Chrd A T 16: 20,738,808 I726F possibly damaging Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Clasp1 T A 1: 118,543,197 Y197* probably null Het
Cyp2c69 C G 19: 39,849,408 G410A probably benign Het
Cyp2e1 G A 7: 140,763,908 V20I possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Dnah5 A T 15: 28,372,375 D2924V probably damaging Het
Efcab12 A T 6: 115,814,549 L554Q possibly damaging Het
Emsy T C 7: 98,597,104 T228A possibly damaging Het
Evc2 G A 5: 37,421,860 V1106I probably benign Het
Exoc8 G T 8: 124,897,470 Q53K possibly damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fbn2 A T 18: 58,056,272 V1594D probably damaging Het
Fer1l4 T C 2: 156,045,623 Y551C possibly damaging Het
Fmnl3 A G 15: 99,323,481 M481T probably benign Het
Fras1 A G 5: 96,735,238 N2543S probably damaging Het
Fsd2 T C 7: 81,559,680 D138G probably damaging Het
Gda C T 19: 21,428,628 V5I probably benign Het
Glt8d2 A T 10: 82,660,749 D158E probably damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Greb1l A G 18: 10,532,922 M830V probably benign Het
Hnrnpul1 A C 7: 25,726,833 V531G probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Igsf3 G C 3: 101,458,094 R1127P probably benign Het
Il1rl1 A G 1: 40,450,188 R367G probably damaging Het
Islr T C 9: 58,157,687 D179G possibly damaging Het
Jcad G T 18: 4,649,338 E70* probably null Het
Kcnd2 T C 6: 21,723,212 I467T probably benign Het
Lrrc27 A G 7: 139,242,698 T502A probably benign Het
Lrrtm3 T A 10: 64,088,002 H462L probably benign Het
Mbd5 T C 2: 49,250,156 L44S probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Mgam A T 6: 40,714,632 probably null Het
Mipep T A 14: 60,872,103 I643N probably damaging Het
Mmrn1 A T 6: 60,988,473 I1162L probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Mug1 G A 6: 121,884,641 C1354Y probably damaging Het
Nbeal2 A T 9: 110,632,055 S1647T probably benign Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nedd9 A T 13: 41,338,575 probably null Het
Nr4a2 T A 2: 57,112,093 H116L probably benign Het
Nwd2 A G 5: 63,794,322 Y232C probably damaging Het
Odf4 A G 11: 68,926,688 L58P probably damaging Het
Olfr1197 T A 2: 88,728,712 M296L possibly damaging Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr1284 T A 2: 111,379,645 L215H probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr434 T A 6: 43,216,949 V12D probably benign Het
Olfr58 C T 9: 19,783,300 H18Y probably damaging Het
Olfr938 A G 9: 39,078,262 V161A probably benign Het
Orc6 T A 8: 85,302,950 I41K probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Prdx6b T C 2: 80,293,060 L71P probably damaging Het
Prmt2 A G 10: 76,226,221 I50T probably damaging Het
Ptdss1 T C 13: 66,995,418 probably null Het
Pygl T C 12: 70,207,758 T138A possibly damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rbl2 A G 8: 91,085,568 Y255C probably damaging Het
Rev3l T A 10: 39,823,397 S1297T probably damaging Het
Rgma C A 7: 73,417,816 T367K probably damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Rslcan18 A T 13: 67,098,526 C217S probably damaging Het
Rtp3 A G 9: 110,986,211 probably benign Het
Ryr1 A T 7: 29,045,662 N3848K probably damaging Het
Sema6a T A 18: 47,248,712 T923S probably benign Het
Serpinb6d A T 13: 33,671,353 T337S possibly damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sidt1 A T 16: 44,269,858 Y369* probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a17 A C 15: 81,327,326 L163W probably damaging Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Sptbn1 T C 11: 30,137,197 T1081A possibly damaging Het
Sptbn4 T C 7: 27,417,006 D456G probably benign Het
Sycp1 C A 3: 102,853,489 A703S possibly damaging Het
Tas2r118 T A 6: 23,969,226 M279L probably benign Het
Tc2n T G 12: 101,694,573 Q133H probably benign Het
Tctn1 A G 5: 122,261,405 probably null Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tex10 A T 4: 48,468,984 S64T probably benign Het
Tex15 A G 8: 33,582,497 T2691A probably benign Het
Tmem175 A T 5: 108,642,150 T123S probably damaging Het
Tsc1 C A 2: 28,672,407 S348R probably damaging Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Ttll8 A T 15: 88,917,090 I465N probably damaging Het
Ubr3 A G 2: 69,938,370 probably benign Het
Ugdh A T 5: 65,423,352 probably null Het
Usp34 T C 11: 23,487,215 L3326S probably damaging Het
Vmn2r125 A T 4: 156,349,981 I21F probably damaging Het
Vps9d1 G A 8: 123,248,612 probably benign Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zbtb12 T C 17: 34,895,499 S87P probably damaging Het
Zc3h12a A G 4: 125,120,893 M266T probably damaging Het
Zfp108 G A 7: 24,260,412 A143T probably benign Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
effervescence UTSW 11 84262474 missense probably benign 0.41
fizz UTSW 11 84245856 missense probably damaging 0.98
greenhouse UTSW 11 84338356 missense probably damaging 1.00
Serene UTSW 11 84311409 splice site probably null
Tranquil UTSW 11 84280461 missense probably damaging 1.00
vitamin UTSW 11 84280435 missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1682:Acaca UTSW 11 84392217 missense probably benign 0.23
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3551:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 splice site probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4696:Acaca UTSW 11 84280435 missense possibly damaging 0.78
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4821:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6736:Acaca UTSW 11 84238838 missense probably benign 0.05
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
R7035:Acaca UTSW 11 84238943 missense probably damaging 1.00
R7078:Acaca UTSW 11 84263312 missense possibly damaging 0.91
R7088:Acaca UTSW 11 84278957 critical splice donor site probably null
R7201:Acaca UTSW 11 84262474 missense probably benign 0.41
R7261:Acaca UTSW 11 84368700 missense probably damaging 1.00
R7399:Acaca UTSW 11 84260679 missense possibly damaging 0.89
R7421:Acaca UTSW 11 84363736 missense possibly damaging 0.64
R7443:Acaca UTSW 11 84315793 missense probably benign 0.02
R7453:Acaca UTSW 11 84245310 missense probably benign
R7471:Acaca UTSW 11 84277782 splice site probably null
R7519:Acaca UTSW 11 84245856 missense probably damaging 0.98
R7537:Acaca UTSW 11 84260634 missense probably damaging 1.00
R7574:Acaca UTSW 11 84261588 missense probably benign
R7633:Acaca UTSW 11 84372639 missense probably benign 0.26
R7643:Acaca UTSW 11 84338356 missense probably damaging 1.00
R7664:Acaca UTSW 11 84245349 missense probably damaging 1.00
R7675:Acaca UTSW 11 84315916 missense probably benign 0.04
R7676:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R7729:Acaca UTSW 11 84371513 missense probably damaging 0.98
R7867:Acaca UTSW 11 84249524 missense possibly damaging 0.88
R7898:Acaca UTSW 11 84364449 critical splice donor site probably null
R7909:Acaca UTSW 11 84245235 missense possibly damaging 0.56
R7915:Acaca UTSW 11 84276588 missense probably benign
R7956:Acaca UTSW 11 84320580 missense probably damaging 0.98
R8000:Acaca UTSW 11 84392231 missense possibly damaging 0.88
R8038:Acaca UTSW 11 84215904 missense probably damaging 1.00
R8545:Acaca UTSW 11 84345968 missense probably damaging 1.00
R8722:Acaca UTSW 11 84338457 missense possibly damaging 0.85
R9005:Acaca UTSW 11 84371584 missense probably damaging 0.99
R9130:Acaca UTSW 11 84311319 missense probably damaging 1.00
R9397:Acaca UTSW 11 84368725 missense probably damaging 1.00
R9489:Acaca UTSW 11 84293016 missense probably benign 0.01
R9540:Acaca UTSW 11 84243411 missense probably damaging 1.00
R9593:Acaca UTSW 11 84380513 nonsense probably null
R9605:Acaca UTSW 11 84293016 missense probably benign 0.01
R9634:Acaca UTSW 11 84293990 missense probably benign 0.00
R9720:Acaca UTSW 11 84263357 missense probably damaging 1.00
RF014:Acaca UTSW 11 84231724 missense probably benign 0.01
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Z1176:Acaca UTSW 11 84260720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACATACACATATGCATGC -3'
(R):5'- AGTAGCACTCCACCTTCAGTTTTAAC -3'

Sequencing Primer
(F):5'- TAACAGATGCTGGGTTCCAC -3'
(R):5'- TCCACCTTCAGTTTTAACTATCTTTG -3'
Posted On 2015-10-21