Mutagenetix > Incidental Mutation

Incidental Mutation 'R4707:Pygl'

355360

Institutional Source

Beutler Lab

Gene Symbol

Pygl

Ensembl Gene

ENSMUSG00000021069

Gene Name

liver glycogen phosphorylase

Synonyms

MMRRC Submission

041955-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.387) question?

Stock #

R4707 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70190811-70231488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70207758 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 138 (T138A)

Ref Sequence

ENSEMBL: ENSMUSP00000125585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]

AlphaFold

Q9ET01

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071250
AA Change: T229A

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: T229A

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	113	829	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161083
AA Change: T138A

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: T138A

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	21	739	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161840

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222093

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	A	G	17: 9,005,712	K450R	probably damaging	Het
Abcd2	T	C	15: 91,159,182	D601G	probably benign	Het
Abcf3	A	G	16: 20,549,058	K56E	possibly damaging	Het
Acaca	T	C	11: 84,312,854	V1477A	probably damaging	Het
Adamts20	G	A	15: 94,333,647	P887L	possibly damaging	Het
Ahnak	T	G	19: 9,016,735	S5128A	probably benign	Het
Ahsa2	C	A	11: 23,493,162	V197F	probably benign	Het
Ak9	C	A	10: 41,345,460	H402N	probably benign	Het
Alpk1	G	T	3: 127,687,592	N175K	possibly damaging	Het
Als2	A	G	1: 59,215,313	V295A	probably benign	Het
Ankrd16	A	G	2: 11,778,797	D70G	probably damaging	Het
Apob	A	T	12: 8,006,205	K1562N	probably damaging	Het
Arfgap2	C	A	2: 91,269,971	S250R	probably damaging	Het
Arhgef10l	C	T	4: 140,536,883	M671I	possibly damaging	Het
Atrnl1	A	G	19: 57,629,158	I122V	probably damaging	Het
B4galnt2	C	T	11: 95,876,097		probably null	Het
C8a	A	G	4: 104,856,421	Y171H	probably damaging	Het
Cacnb4	A	G	2: 52,474,915	V112A	probably benign	Het
Capn9	G	T	8: 124,613,456	C566F	possibly damaging	Het
Ccdc88a	T	A	11: 29,447,956	S230T	probably benign	Het
Cd300c2	A	T	11: 114,996,985	F197Y	probably benign	Het
Chd5	A	G	4: 152,360,582	Y340C	probably damaging	Het
Chrd	A	T	16: 20,738,808	I726F	possibly damaging	Het
Chrna10	G	A	7: 102,113,219	P255S	possibly damaging	Het
Clasp1	T	A	1: 118,543,197	Y197*	probably null	Het
Cyp2c69	C	G	19: 39,849,408	G410A	probably benign	Het
Cyp2e1	G	A	7: 140,763,908	V20I	possibly damaging	Het
Dapp1	T	C	3: 137,933,167	D225G	probably benign	Het
Dnah5	A	T	15: 28,372,375	D2924V	probably damaging	Het
Efcab12	A	T	6: 115,814,549	L554Q	possibly damaging	Het
Emsy	T	C	7: 98,597,104	T228A	possibly damaging	Het
Evc2	G	A	5: 37,421,860	V1106I	probably benign	Het
Exoc8	G	T	8: 124,897,470	Q53K	possibly damaging	Het
Fam160a1	G	T	3: 85,688,570	T115K	probably damaging	Het
Fbn2	A	T	18: 58,056,272	V1594D	probably damaging	Het
Fer1l4	T	C	2: 156,045,623	Y551C	possibly damaging	Het
Fmnl3	A	G	15: 99,323,481	M481T	probably benign	Het
Fras1	A	G	5: 96,735,238	N2543S	probably damaging	Het
Fsd2	T	C	7: 81,559,680	D138G	probably damaging	Het
Gda	C	T	19: 21,428,628	V5I	probably benign	Het
Glt8d2	A	T	10: 82,660,749	D158E	probably damaging	Het
Gpx6	C	T	13: 21,312,264	Q3*	probably null	Het
Greb1l	A	G	18: 10,532,922	M830V	probably benign	Het
Hnrnpul1	A	C	7: 25,726,833	V531G	probably damaging	Het
Ifi206	A	T	1: 173,480,866	H521Q	probably benign	Het
Igsf3	G	C	3: 101,458,094	R1127P	probably benign	Het
Il1rl1	A	G	1: 40,450,188	R367G	probably damaging	Het
Islr	T	C	9: 58,157,687	D179G	possibly damaging	Het
Jcad	G	T	18: 4,649,338	E70*	probably null	Het
Kcnd2	T	C	6: 21,723,212	I467T	probably benign	Het
Lrrc27	A	G	7: 139,242,698	T502A	probably benign	Het
Lrrtm3	T	A	10: 64,088,002	H462L	probably benign	Het
Mbd5	T	C	2: 49,250,156	L44S	probably damaging	Het
Mccc1	C	A	3: 35,975,873	M429I	probably damaging	Het
Mgam	A	T	6: 40,714,632		probably null	Het
Mipep	T	A	14: 60,872,103	I643N	probably damaging	Het
Mmrn1	A	T	6: 60,988,473	I1162L	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mug1	G	A	6: 121,884,641	C1354Y	probably damaging	Het
Nbeal2	A	T	9: 110,632,055	S1647T	probably benign	Het
Ndufaf2	C	G	13: 108,052,780	A145P	probably damaging	Het
Nedd9	A	T	13: 41,338,575		probably null	Het
Nr4a2	T	A	2: 57,112,093	H116L	probably benign	Het
Nwd2	A	G	5: 63,794,322	Y232C	probably damaging	Het
Odf4	A	G	11: 68,926,688	L58P	probably damaging	Het
Olfr1197	T	A	2: 88,728,712	M296L	possibly damaging	Het
Olfr1221	A	T	2: 89,112,232	F93L	probably damaging	Het
Olfr1284	T	A	2: 111,379,645	L215H	probably damaging	Het
Olfr284	G	T	15: 98,340,778	H70Q	possibly damaging	Het
Olfr434	T	A	6: 43,216,949	V12D	probably benign	Het
Olfr58	C	T	9: 19,783,300	H18Y	probably damaging	Het
Olfr938	A	G	9: 39,078,262	V161A	probably benign	Het
Orc6	T	A	8: 85,302,950	I41K	probably damaging	Het
Pikfyve	A	G	1: 65,267,846	T1798A	probably benign	Het
Prdx6b	T	C	2: 80,293,060	L71P	probably damaging	Het
Prmt2	A	G	10: 76,226,221	I50T	probably damaging	Het
Ptdss1	T	C	13: 66,995,418		probably null	Het
Rab3c	T	C	13: 110,061,900	E198G	probably benign	Het
Rbl2	A	G	8: 91,085,568	Y255C	probably damaging	Het
Rev3l	T	A	10: 39,823,397	S1297T	probably damaging	Het
Rgma	C	A	7: 73,417,816	T367K	probably damaging	Het
Rps6ka5	C	T	12: 100,597,885		probably null	Het
Rslcan18	A	T	13: 67,098,526	C217S	probably damaging	Het
Rtp3	A	G	9: 110,986,211		probably benign	Het
Ryr1	A	T	7: 29,045,662	N3848K	probably damaging	Het
Sema6a	T	A	18: 47,248,712	T923S	probably benign	Het
Serpinb6d	A	T	13: 33,671,353	T337S	possibly damaging	Het
Sf3b1	G	A	1: 54,990,507	T1112M	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sidt1	A	T	16: 44,269,858	Y369*	probably null	Het
Slc16a6	A	G	11: 109,463,367	S59P	probably benign	Het
Slc25a17	A	C	15: 81,327,326	L163W	probably damaging	Het
Slc44a3	T	C	3: 121,527,074	T93A	possibly damaging	Het
Sptbn1	T	C	11: 30,137,197	T1081A	possibly damaging	Het
Sptbn4	T	C	7: 27,417,006	D456G	probably benign	Het
Sycp1	C	A	3: 102,853,489	A703S	possibly damaging	Het
Tas2r118	T	A	6: 23,969,226	M279L	probably benign	Het
Tc2n	T	G	12: 101,694,573	Q133H	probably benign	Het
Tctn1	A	G	5: 122,261,405		probably null	Het
Tenm4	A	C	7: 96,774,046	K683Q	probably damaging	Het
Tex10	A	T	4: 48,468,984	S64T	probably benign	Het
Tex15	A	G	8: 33,582,497	T2691A	probably benign	Het
Tmem175	A	T	5: 108,642,150	T123S	probably damaging	Het
Tsc1	C	A	2: 28,672,407	S348R	probably damaging	Het
Ttll4	A	T	1: 74,679,007	T6S	possibly damaging	Het
Ttll8	A	T	15: 88,917,090	I465N	probably damaging	Het
Ubr3	A	G	2: 69,938,370		probably benign	Het
Ugdh	A	T	5: 65,423,352		probably null	Het
Usp34	T	C	11: 23,487,215	L3326S	probably damaging	Het
Vmn2r125	A	T	4: 156,349,981	I21F	probably damaging	Het
Vps9d1	G	A	8: 123,248,612		probably benign	Het
Xab2	G	A	8: 3,618,117	R154C	possibly damaging	Het
Zbtb12	T	C	17: 34,895,499	S87P	probably damaging	Het
Zc3h12a	A	G	4: 125,120,893	M266T	probably damaging	Het
Zfp108	G	A	7: 24,260,412	A143T	probably benign	Het

Other mutations in Pygl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pygl	APN	12	70191092	missense	probably damaging	1.00
IGL00903:Pygl	APN	12	70207742	missense	probably damaging	1.00
IGL01965:Pygl	APN	12	70191114	missense	probably benign	0.00
IGL02347:Pygl	APN	12	70201892	missense	probably benign	0.14
IGL02403:Pygl	APN	12	70194258	missense	probably benign
IGL02501:Pygl	APN	12	70191134	missense	probably benign	0.05
IGL02727:Pygl	APN	12	70207668	splice site	probably null
IGL03125:Pygl	APN	12	70197482	missense	probably damaging	1.00
IGL03158:Pygl	APN	12	70195675	missense	probably damaging	1.00
IGL03202:Pygl	APN	12	70199646	missense	probably benign
IGL03368:Pygl	APN	12	70191152	missense	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0524:Pygl	UTSW	12	70207724	missense	probably damaging	1.00
R0883:Pygl	UTSW	12	70206404	missense	probably damaging	0.97
R0894:Pygl	UTSW	12	70194374	splice site	probably benign
R0905:Pygl	UTSW	12	70211017	splice site	probably benign
R1494:Pygl	UTSW	12	70199730	missense	probably damaging	0.98
R1621:Pygl	UTSW	12	70191092	missense	probably damaging	1.00
R1647:Pygl	UTSW	12	70197010	missense	possibly damaging	0.60
R3082:Pygl	UTSW	12	70197529	missense	probably damaging	1.00
R3845:Pygl	UTSW	12	70198443	missense	probably benign	0.12
R3876:Pygl	UTSW	12	70201339	missense	probably damaging	1.00
R4358:Pygl	UTSW	12	70195690	missense	probably damaging	1.00
R4614:Pygl	UTSW	12	70210979	splice site	probably null
R4908:Pygl	UTSW	12	70197033	missense	probably null
R4940:Pygl	UTSW	12	70206381	missense	probably damaging	1.00
R5077:Pygl	UTSW	12	70201892	missense	probably benign	0.14
R5186:Pygl	UTSW	12	70201344	missense	probably damaging	1.00
R5726:Pygl	UTSW	12	70191142	nonsense	probably null
R5953:Pygl	UTSW	12	70219627	missense	probably damaging	1.00
R5957:Pygl	UTSW	12	70199720	missense	probably damaging	0.99
R6020:Pygl	UTSW	12	70216654	missense	probably damaging	1.00
R6024:Pygl	UTSW	12	70197067	missense	probably benign	0.09
R7050:Pygl	UTSW	12	70219622	missense	probably damaging	1.00
R7159:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R7194:Pygl	UTSW	12	70194320	missense	probably benign
R7283:Pygl	UTSW	12	70216568	missense	possibly damaging	0.92
R7360:Pygl	UTSW	12	70227532	missense	probably benign	0.11
R7446:Pygl	UTSW	12	70197010	missense	probably benign
R7637:Pygl	UTSW	12	70197795	splice site	probably null
R7886:Pygl	UTSW	12	70206356	splice site	probably null
R8054:Pygl	UTSW	12	70227339	critical splice donor site	probably null
R8693:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R8753:Pygl	UTSW	12	70195626	missense	probably damaging	1.00
R8803:Pygl	UTSW	12	70195616	missense	probably damaging	1.00
R8842:Pygl	UTSW	12	70227594	intron	probably benign
R9192:Pygl	UTSW	12	70197048	missense	probably damaging	0.99
R9221:Pygl	UTSW	12	70195627	missense	probably damaging	1.00
R9437:Pygl	UTSW	12	70200151	missense	probably damaging	1.00
R9750:Pygl	UTSW	12	70198529	missense	possibly damaging	0.68
Z1176:Pygl	UTSW	12	70222874	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- AGGCTCTTCTCTTAAGCTCAATTTG -3'
(R):5'- ACGTTCATGTGCATCACTTTGC -3'

Sequencing Primer
(F):5'- TTGTCTCTAACCAGCCATCAAGATG -3'
(R):5'- GCATCACTTTGCTTCTACATCATAG -3'

Posted On

2015-10-21